ID: 992921103

View in Genome Browser
Species Human (GRCh38)
Location 5:81521752-81521774
Sequence TTGTTGTAATGTTGGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992921099_992921103 23 Left 992921099 5:81521706-81521728 CCTGGAATAATGTGAACCTTTCC 0: 1
1: 0
2: 1
3: 9
4: 131
Right 992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 307
992921101_992921103 2 Left 992921101 5:81521727-81521749 CCAATGTTCGTACTTAGTTTCTT 0: 1
1: 0
2: 0
3: 7
4: 129
Right 992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 307
992921100_992921103 7 Left 992921100 5:81521722-81521744 CCTTTCCAATGTTCGTACTTAGT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992921103 Original CRISPR TTGTTGTAATGTTGGAAAGT TGG Intronic
900272336 1:1797735-1797757 TTGTAGAAATTTTGGAAAGGGGG - Intronic
901498593 1:9637357-9637379 TTTTTGTAATGTTGTAGAGATGG - Intergenic
903802971 1:25983581-25983603 TGGTTCTAACCTTGGAAAGTAGG + Intronic
904282543 1:29431139-29431161 TTGTGGTGGTGTTGGAAGGTGGG + Intergenic
908941461 1:69439921-69439943 CTGTTGTAATGGTGGAATTTGGG - Intergenic
909445192 1:75741589-75741611 TTGTTTTAATTTTGTAAAGATGG - Intronic
910548835 1:88453168-88453190 TTCTTGCAAAGTGGGAAAGTAGG + Intergenic
911157707 1:94653384-94653406 TTGATGGATTGATGGAAAGTGGG - Intergenic
911493555 1:98600461-98600483 TTGTGGTAGTGTTAGAAGGTAGG - Intergenic
913572670 1:120136557-120136579 TTGTTGTAAGTTTTGAAATTGGG - Intergenic
914237942 1:145829394-145829416 TTGAGGTAATTTTGGAAACTGGG - Intronic
914293514 1:146297471-146297493 TTGTTGTAAGTTTTGAAATTGGG - Intergenic
914554558 1:148748254-148748276 TTGTTGTAAGTTTTGAAATTGGG - Intergenic
917644335 1:177015282-177015304 TTCTAGGAATCTTGGAAAGTAGG + Intronic
918667189 1:187166317-187166339 TTGTGGTGGTGTTGGGAAGTGGG + Intergenic
919116393 1:193285397-193285419 TTGTTGCCATTTTGGAATGTAGG + Intergenic
919238839 1:194884360-194884382 TTCTTGTATTTTTGGAAAGCAGG - Intergenic
919256072 1:195127135-195127157 CTGTTTAAATATTGGAAAGTAGG - Intergenic
919867994 1:201797425-201797447 TTGTAGTAAGTTTGGAAATTGGG + Intronic
921317594 1:213906660-213906682 TATTTGTGATGTTGGGAAGTTGG - Intergenic
921688302 1:218117360-218117382 TTGTTGTAGTTTTGCAAAATGGG + Intergenic
1062953239 10:1521494-1521516 TTGAGGCAATGTTGGGAAGTCGG + Intronic
1062990830 10:1814668-1814690 TTGTTGTAAGGTTTGAAATCAGG - Intergenic
1064487755 10:15813440-15813462 TTATTGTAGTTTTGGAAAATTGG - Intronic
1065468536 10:26052239-26052261 TTGTAGCAATGTTGGAAAGAAGG - Intronic
1065556926 10:26925209-26925231 TTGTTGTAAATTTTGAAATTGGG - Intergenic
1067196960 10:44128957-44128979 TGGTTGTAATTTTAGAAAGTCGG - Intergenic
1068358196 10:55939349-55939371 TTGTTGTAATTTTGGTACTTAGG + Intergenic
1069471503 10:68695289-68695311 CTGTAATAATGTTAGAAAGTAGG - Intergenic
1073919650 10:108444099-108444121 TTGTTGCAATCATGAAAAGTAGG - Intergenic
1074036297 10:109742289-109742311 TTTTTGTAATGTTGTAGAGGTGG - Intergenic
1074641134 10:115382102-115382124 TTGTAGTAATGTTTGAAATTGGG + Intronic
1074715739 10:116217033-116217055 TTCTTTTTATGTTGAAAAGTGGG + Intronic
1074960266 10:118438481-118438503 TTTTTGTAATTTTGTAAAGGTGG + Intergenic
1075917130 10:126177776-126177798 TTGTTGCAATGTAAGAAAGCAGG - Intronic
1076775531 10:132695882-132695904 TAGTTCTATGGTTGGAAAGTAGG + Intronic
1076792159 10:132782953-132782975 TTGTTGTAACGTAGGATACTTGG - Exonic
1078167846 11:8905129-8905151 TTGTAGTAAGTTTGGAAATTGGG - Intronic
1078420943 11:11212273-11212295 TTACTTTAATGTTGGAATGTTGG - Intergenic
1078720613 11:13880387-13880409 TGGTGGTAAGGTTGGGAAGTTGG - Intergenic
1079141834 11:17816045-17816067 TTGGGCTACTGTTGGAAAGTGGG + Intronic
1080154328 11:29090744-29090766 TTGTGGTAATGTTGGGCAGCTGG + Intergenic
1082967773 11:58985340-58985362 TTGTAGTATTGTTTGAAATTAGG + Intronic
1087402578 11:97685894-97685916 ATGTTGCAATGTTGGGATGTGGG + Intergenic
1089934308 11:122347927-122347949 GTGTTGTAATAATGGAAAATTGG - Intergenic
1090646298 11:128768998-128769020 TGGCTGTAATTTTGGAAAGGTGG - Intronic
1091129993 11:133138022-133138044 ATGTGGCAGTGTTGGAAAGTGGG + Intronic
1094784314 12:33828510-33828532 ATGTGGCAATGTTGGAAGGTGGG + Intergenic
1094794434 12:33954469-33954491 TTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1096074005 12:48790566-48790588 TTGTTATAATGTTTGAAAATGGG + Intergenic
1096295641 12:50381697-50381719 TGATTGTAATCTTGGAAATTTGG + Intronic
1096947921 12:55430338-55430360 TTGTTGTTGTTTTGGAGAGTAGG - Intergenic
1097281707 12:57848700-57848722 TTGTTTTAATGATGGGAGGTGGG - Intergenic
1098618634 12:72562439-72562461 GTATTGTCATGTTTGAAAGTAGG - Intronic
1098792742 12:74846235-74846257 TTGTTGTACTATTGGAATGCAGG - Intergenic
1099816636 12:87657215-87657237 TTCTTGAAATGTTGGTGAGTGGG - Intergenic
1100790912 12:98128911-98128933 CTGTTGTAATGTGGGAAGGCAGG - Intergenic
1101138496 12:101770708-101770730 TTTTTGTAATGTTTAAAATTAGG - Intronic
1102407906 12:112690143-112690165 TTGTAGAAAAGTTGGAAAATTGG + Intronic
1103928112 12:124434797-124434819 TTGTTGCACTATTGGAAAATAGG - Intronic
1104208641 12:126665340-126665362 TTTTTGTCATTTTGGAAAGTGGG - Intergenic
1104226831 12:126843072-126843094 TTGTTGTTAAGTTATAAAGTTGG - Intergenic
1105586690 13:21751485-21751507 ATGTTCTGATTTTGGAAAGTGGG - Intergenic
1105727618 13:23180713-23180735 GGGTTTAAATGTTGGAAAGTTGG + Intergenic
1105774810 13:23647995-23648017 TTGTAGTAAGGTTTGAAACTGGG + Intronic
1106126466 13:26903715-26903737 ATGGTGGAATGTTGCAAAGTCGG + Intergenic
1106765734 13:32911902-32911924 TTTTTGTAATGGTGAAAAATTGG - Intergenic
1107232678 13:38129538-38129560 TTGTAGTATTGTTTGAAATTGGG + Intergenic
1108786966 13:53915749-53915771 TTGCTGTAGTCTTGGAAATTAGG + Intergenic
1109059973 13:57603662-57603684 TTGTTGTATTGTGGGTAACTTGG + Intergenic
1110829449 13:80013340-80013362 ATGTGGCAGTGTTGGAAAGTGGG + Intergenic
1111485540 13:88894863-88894885 TTGTTGTAATATATGTAAGTGGG + Intergenic
1111725992 13:92009856-92009878 TGGTTTTAAGCTTGGAAAGTAGG - Intronic
1111770952 13:92594925-92594947 TTATTGTAATGTAGCTAAGTAGG + Intronic
1114918414 14:27296053-27296075 ATGTTGAAATGTTGGAAAAGGGG - Intergenic
1115901184 14:38150004-38150026 TTGGGGTAGAGTTGGAAAGTAGG - Intergenic
1115952971 14:38742232-38742254 TTTATGTGATCTTGGAAAGTTGG + Intergenic
1116703890 14:48271769-48271791 TTGGTGTTAGGTGGGAAAGTAGG + Intergenic
1116808640 14:49518274-49518296 CTTTTGGAAAGTTGGAAAGTTGG - Intergenic
1117018009 14:51538802-51538824 TTGTGGTAAGGTTTGAAATTGGG + Intronic
1117448347 14:55826718-55826740 TTGGTGTAATGTTAGAAATATGG - Intergenic
1117487114 14:56209503-56209525 TTGTTTTCATTTTGGAAAATAGG + Intronic
1119460812 14:74801727-74801749 TTGTTGGCATGTGGGAATGTAGG + Intronic
1120427866 14:84373493-84373515 TTGTGGCATTGTTGGGAAGTGGG - Intergenic
1121172062 14:91862868-91862890 TTGTTGTTCTGTTGGAACTTTGG - Intronic
1126223821 15:46246068-46246090 TTGTTGGAATGTTAGGATGTTGG + Intergenic
1126276508 15:46889599-46889621 TTGTAGTAAGTTTGGAAATTGGG - Intergenic
1126395417 15:48210369-48210391 TTGTTGTAAATTGGGGAAGTAGG - Intronic
1126661883 15:51040362-51040384 TTGTTGTAACTTTTGAAATTGGG + Intergenic
1128021425 15:64394138-64394160 ATGTTGAAATATTGGTAAGTGGG + Intronic
1129129338 15:73478489-73478511 TTGTTGTAATTTTTGAAATCAGG + Intronic
1129294095 15:74590261-74590283 TTTTTGTAATGTGGGAAATGGGG - Intronic
1129576367 15:76751463-76751485 TTGTTGTAAGTTTTGAAATTAGG - Intronic
1129956916 15:79646800-79646822 TTGTTATCATATTGGACAGTTGG - Intergenic
1130884233 15:88080128-88080150 TATTTGTAATGATGGAAAATTGG - Intronic
1132276092 15:100565318-100565340 TTGTAACAATGTTAGAAAGTAGG - Intronic
1136482595 16:30551868-30551890 TTGATGAGATGCTGGAAAGTTGG + Intronic
1138418305 16:56884057-56884079 TTGTTGTAGTATTGGAATGAAGG - Exonic
1138731677 16:59201997-59202019 CTGTTGTAATTTTGCAAAGGTGG + Intergenic
1139203322 16:65001682-65001704 TTGTTTTCAGGTTGGAAAGTAGG + Intronic
1140199577 16:72884069-72884091 TTGTTTTTATTTTGCAAAGTTGG - Intronic
1142563673 17:826036-826058 GTGATGGAATGTTGGAAATTCGG + Exonic
1145393963 17:22479228-22479250 TTTTTGTAATTTTGGAGAGATGG - Intergenic
1146116584 17:30146017-30146039 TTTTTGTATTTTTGTAAAGTTGG + Intronic
1147334597 17:39719713-39719735 TTGTTGTGAGGCTGGAAAGGTGG + Intronic
1147435493 17:40410736-40410758 TTGTTTTTTTGTTGGAGAGTGGG + Intronic
1148623341 17:49050991-49051013 TTGTTGCAATGTTGAAAGGAGGG - Exonic
1148713308 17:49697679-49697701 TTTTTGTAATTTTGGAGAGACGG - Intergenic
1149423693 17:56534573-56534595 CTGTTAAAATGTTGGAAAGGAGG - Intergenic
1151270520 17:72991760-72991782 TTCTTGTAATGGTGAAAAATTGG - Intronic
1152337944 17:79708496-79708518 GTGTTTTAATGCAGGAAAGTAGG - Intergenic
1153324862 18:3808244-3808266 TTCTTATTATATTGGAAAGTGGG + Intronic
1153324870 18:3808324-3808346 TTCTTATTATATTGGAAAGTGGG + Intronic
1155301439 18:24433067-24433089 TTGTTCTAATGGTGGAATATGGG + Intronic
1155528584 18:26742910-26742932 TTGTTGTTATTTTGGAGAGTGGG - Intergenic
1156605119 18:38657216-38657238 TTTTTCTGATGGTGGAAAGTGGG - Intergenic
1157463208 18:47920411-47920433 TTTTTGTACTGTTAGAAAATTGG + Intronic
1157874777 18:51261928-51261950 CTGTGGTAGTGTTGGAGAGTAGG + Intergenic
1158059624 18:53323680-53323702 TGGTTGGAAGGTTGGAAGGTTGG + Intronic
1159225587 18:65530614-65530636 TTGTTTCAATGCTGGTAAGTTGG + Intergenic
1159532629 18:69674184-69674206 TAGTTGTAATATTTGAAAGGTGG + Intronic
1159733722 18:72065780-72065802 TAGTTGTAATTTTGGAAAAAAGG - Intergenic
1159934919 18:74356678-74356700 ATGTTGTAATAGTGAAAAGTTGG - Exonic
1161435914 19:4262736-4262758 TTTTTGTAATTTTGTAAAGAAGG - Intronic
1162882500 19:13670410-13670432 TTGTTTTTCTGCTGGAAAGTGGG + Intergenic
928919902 2:36515983-36516005 TTGTTCTTATACTGGAAAGTTGG + Intronic
929762324 2:44816487-44816509 TTGTTGAGATGTGGGACAGTTGG + Intergenic
930195781 2:48508531-48508553 TTGTTGGAATGCAGGAAAGGGGG + Intronic
931370329 2:61656364-61656386 TTGTTGTAAGGATTAAAAGTGGG + Intergenic
931509372 2:62973827-62973849 TTTTTGTAATTTTGGAGAGATGG - Intronic
932571613 2:72941241-72941263 CTGTTGTAAGGATGGAAAGCTGG - Intergenic
934123178 2:88859933-88859955 TTATTGTAATGGTGGAAAGGTGG - Intergenic
936876275 2:117193359-117193381 TTGTTGTTTTGTTGGTTAGTTGG + Intergenic
936911878 2:117602047-117602069 TTGTTGTATTTTTGAAATGTTGG - Intergenic
937842701 2:126539690-126539712 ATGTTTTAATGTTGGAAGGTGGG - Intergenic
939278503 2:140032185-140032207 ATGTTGTAATTTTAGAAAGAGGG + Intergenic
940922818 2:159328558-159328580 TTGTTGCCATGTAGGAATGTGGG - Intronic
943173867 2:184442493-184442515 TTGTTATAATATTGGAAAGTTGG + Intergenic
943706563 2:191041437-191041459 TTATTTTAATGTTTGAAAATTGG + Intronic
944422041 2:199541777-199541799 TTGTTGCCATGTGGGAATGTGGG + Intergenic
946172279 2:217902570-217902592 GTGTTGTAATGTTTGGAAGAGGG - Intronic
947902273 2:233731219-233731241 TTGTAAAAATGTTGAAAAGTGGG + Intronic
947904343 2:233749318-233749340 TTGTAACAATGTTGAAAAGTGGG + Intronic
947996832 2:234534956-234534978 TTGCTGTAAGGGTGGACAGTTGG + Intergenic
949058460 2:241942745-241942767 TTCTTGTTATTTTGGAAAGCTGG + Intergenic
1169633012 20:7654655-7654677 TTGTTGAAATCTGGGAAAGTTGG - Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172438610 20:34948950-34948972 TTGTTGCCATGCAGGAAAGTAGG + Intronic
1173215614 20:41079553-41079575 TTGTTGTAATGTTGTCAGCTTGG + Intronic
1173905762 20:46627494-46627516 TTGTTGTGATGCAGGAATGTGGG + Intronic
1173939292 20:46895648-46895670 TCGTTGTAATGGGAGAAAGTGGG + Intronic
1174438856 20:50532465-50532487 TGCTTGAAAAGTTGGAAAGTTGG + Intronic
1174568313 20:51483145-51483167 TGTTTGTAATGGGGGAAAGTTGG - Intronic
1175116544 20:56686713-56686735 TTGTTTTAATGATGGAAACAAGG + Intergenic
1175116610 20:56687107-56687129 TTGTTTTAATGATGGAAACAAGG + Intergenic
1175565331 20:59970924-59970946 TTGTTGTAATGTGGGAATGTGGG - Intronic
1176864831 21:14041590-14041612 TTGTTGGAATGTTAGGACGTTGG + Intergenic
1178184511 21:30204795-30204817 TATTTATAATGATGGAAAGTTGG - Intergenic
1180585828 22:16889018-16889040 TTGTTTTGATGTTGGATATTTGG + Intergenic
952313024 3:32207523-32207545 TTGTTGCCATGTTGGAATGTTGG + Intergenic
952594251 3:34996775-34996797 TTGTAGTAAATTTGGAAAGAAGG - Intergenic
953327045 3:42021011-42021033 TTCTTGTCATGTTCGGAAGTTGG + Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955794447 3:62621188-62621210 TTGCTGTATTCTTGGAAACTTGG + Intronic
955951446 3:64246430-64246452 TTATTCTTATGTTGGAAGGTAGG - Intronic
956422669 3:69100925-69100947 CTGTTGACATGTGGGAAAGTGGG + Intronic
956761648 3:72448958-72448980 TTGTTCTAATGGTGGAAAGAGGG - Intergenic
956887274 3:73572882-73572904 TTGTTGGAATTTTGAAAAGATGG + Intronic
957221073 3:77382923-77382945 TTGTTGGCATGTTGGCAACTAGG - Intronic
957275673 3:78088363-78088385 TTTTAGAAAAGTTGGAAAGTAGG - Intergenic
957517989 3:81280897-81280919 TTGTTGTTGTTTTGGAAAATTGG - Intergenic
957644036 3:82896330-82896352 TTGGTGTAATATTTGAAAGTAGG + Intergenic
959194555 3:103163023-103163045 ATGTGATAATGTTGGGAAGTGGG - Intergenic
959374050 3:105565663-105565685 TTGTTTGGATGTTGGAAATTTGG + Intronic
961232080 3:125323590-125323612 TTGTTTTTATGTTTGAAATTGGG + Intronic
963313509 3:143733802-143733824 TGGTAGTATTGGTGGAAAGTGGG - Intronic
965124249 3:164604577-164604599 TTATTGTAATGTTGCAAATTTGG - Intergenic
965237244 3:166140541-166140563 TTATTGTATTATTGGAAAGTGGG + Intergenic
965932691 3:174066151-174066173 TATTTGTATTGTGGGAAAGTTGG - Intronic
966299006 3:178458009-178458031 TTGTTGTAATGGGGAAAAGTTGG - Intronic
966846825 3:184137172-184137194 TTGTTGAAATCTTGAAAACTAGG + Intronic
968544396 4:1191198-1191220 TTGTAGTAATTTTTGAAATTGGG - Intronic
970390845 4:15611659-15611681 TTCTTGTGATTTTTGAAAGTAGG + Intronic
970507616 4:16747510-16747532 TTGTTTTAAAGCTTGAAAGTTGG + Intronic
971129315 4:23788489-23788511 TTGTTTTCCTGTTGGATAGTCGG + Intronic
971832504 4:31714454-31714476 TTGTTCTAAGATTGGAAACTTGG + Intergenic
972168270 4:36313541-36313563 ATTATGTAATTTTGGAAAGTTGG - Intronic
972180514 4:36458923-36458945 TTTTTTTAATGTTGCAAAGTAGG - Intergenic
973485480 4:51050265-51050287 TTTTTGTAATATTTGGAAGTTGG + Intergenic
973932279 4:55805146-55805168 TTTTTGTAATGATGGGGAGTGGG + Intergenic
974578309 4:63759274-63759296 ATGTTATACTGTTGGAAAATAGG + Intergenic
975067911 4:70092282-70092304 TTGTTGTATTGTTGAATATTAGG - Intergenic
975281172 4:72564637-72564659 TTCTTGGTATGTGGGAAAGTAGG - Intronic
975368906 4:73561086-73561108 GTGTGGTACTGTTTGAAAGTGGG + Intergenic
976143076 4:82013306-82013328 TTGTGGTAATGTTAGGAAATGGG + Intronic
976163268 4:82226770-82226792 TTGTGGAAAACTTGGAAAGTAGG - Intergenic
976608414 4:87004448-87004470 TTTTTTTAATTTTGGAAAATTGG - Intronic
976756261 4:88501205-88501227 GTGTTGTAATTTTGGACAGGAGG - Intronic
976933064 4:90592297-90592319 TTGTGATAATGCTTGAAAGTTGG + Intronic
977157147 4:93588859-93588881 TTGTTGTATAGCTGGAAAGCAGG - Intronic
977308385 4:95354054-95354076 TTGTTTTTATGTTGGAAATGAGG - Intronic
978640373 4:110863993-110864015 ATGTTATAATGTTTTAAAGTAGG + Intergenic
979586703 4:122427887-122427909 TTATTGTAAGTTTTGAAAGTAGG - Intronic
981932331 4:150204488-150204510 TTGTTGAAATTTTGCAAAATTGG - Intronic
981966938 4:150615144-150615166 TTGGTGAAATGATGGAATGTAGG + Intronic
982450496 4:155546732-155546754 TTGATAGTATGTTGGAAAGTAGG - Intergenic
982503542 4:156190333-156190355 TTATTGTAAACTTGGGAAGTTGG + Intergenic
983270913 4:165560570-165560592 ATTTTGTAATGGTGGAAAGTTGG + Intergenic
985976591 5:3423483-3423505 TTGTAGTAATTTTTGAAAGCAGG - Intergenic
986212406 5:5686322-5686344 TTGCTTTAATGGGGGAAAGTTGG - Intergenic
986420922 5:7581088-7581110 GAGTTGAAATGATGGAAAGTTGG + Intronic
987637187 5:20558898-20558920 TGCTTGAAATTTTGGAAAGTGGG + Intronic
989876859 5:46706735-46706757 TTTTTGTAATGTCTGCAAGTGGG + Intergenic
991041593 5:62181682-62181704 TTGTTGAAATGTTGTCAAGACGG + Intergenic
992844840 5:80736053-80736075 TTTTTGTATTTTTGGAAAGATGG - Intronic
992921103 5:81521752-81521774 TTGTTGTAATGTTGGAAAGTTGG + Intronic
993349300 5:86827616-86827638 TTGTTGACATGTTGAAAATTTGG - Intergenic
993769472 5:91907313-91907335 TTGGGGTAATATTGGAAGGTAGG + Intergenic
994687455 5:102972888-102972910 TTGGTTTAATGTTTCAAAGTAGG - Intronic
994842514 5:104943659-104943681 TTGCTGTAATGTTAAAAATTCGG + Intergenic
994916969 5:105993491-105993513 TTGCTGTCATGTTAGGAAGTGGG - Intergenic
995716590 5:115086827-115086849 TTGTTGCATTGTTATAAAGTGGG - Intergenic
995838222 5:116419416-116419438 TTGTTCTCATGGTGAAAAGTGGG - Intergenic
996191098 5:120542584-120542606 TTGTTTTTATGTTGAAAAGATGG - Intronic
1000028439 5:157380497-157380519 CTGTTATAATTTTGGAAAGGTGG + Intronic
1000748686 5:165067814-165067836 TTTGTGTAATTTTGGAAAGAAGG - Intergenic
1002496581 5:179617680-179617702 TTTTTGTAACGTTAGAAAGTTGG - Intronic
1002509935 5:179708225-179708247 GTGTTGTCTTGTAGGAAAGTGGG + Exonic
1003429585 6:6026707-6026729 TCCTTGTATTGTTGGAAAGGTGG + Intergenic
1004852897 6:19718604-19718626 ATGTTTTAATGATGGAAAGCTGG + Intergenic
1005032753 6:21526575-21526597 ATGTTCTCATGTTGGAGAGTTGG - Intergenic
1005391649 6:25339962-25339984 ATGTTGGGATCTTGGAAAGTGGG - Intronic
1005658093 6:27964546-27964568 TTGTAGTAAGTTTGGAAATTAGG + Intergenic
1006242518 6:32697514-32697536 TAATAGCAATGTTGGAAAGTAGG - Intergenic
1006896843 6:37476629-37476651 GGGTTGTAATGTTAGATAGTGGG + Intronic
1010022359 6:71175230-71175252 TTGTTTTAATGTTTGAAAATAGG - Intergenic
1010451242 6:76005663-76005685 ATGTTGAAATGTTTTAAAGTGGG - Intronic
1010961003 6:82145787-82145809 TTGTTGTACTGTTACAAATTGGG - Intergenic
1011157825 6:84353264-84353286 TTATTGTGATGTTGGCATGTTGG + Intergenic
1011731648 6:90270812-90270834 TTGTAGTATAGTTGGAAATTGGG - Intronic
1012500398 6:99881839-99881861 TTGTTGTAAGGTTGCAAAACTGG + Intergenic
1014335328 6:120126550-120126572 ATGTTATAATGTTGGAAGGTAGG - Intergenic
1015040405 6:128710504-128710526 TGGTTTTATTGTTGGAAAGAGGG + Intergenic
1015122457 6:129714528-129714550 TTGTTATAATATTGAAAATTGGG - Intergenic
1015423557 6:133038781-133038803 TTGTGGGACTGTTGTAAAGTGGG + Intergenic
1015424607 6:133051147-133051169 TTGTTGTCATTTTGAAATGTTGG + Intergenic
1016920977 6:149292999-149293021 TGATTGAAATGTTGGCAAGTTGG + Intronic
1017023088 6:150157351-150157373 TTGTTTTGATTTTGTAAAGTGGG - Intronic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1018415572 6:163599669-163599691 TTGTTGTAAAGATGGAAATGAGG + Intergenic
1019028850 6:168993520-168993542 TTGTTGTATTTTTGGAGAGATGG + Intergenic
1020454707 7:8358830-8358852 ATGGTGTAATGTTAGAAACTTGG + Intergenic
1021296328 7:18911300-18911322 TTGTTGTATAGTTGTATAGTTGG + Intronic
1021413880 7:20359501-20359523 TTCTTGTAATGTTGGATGGGAGG + Intronic
1021944407 7:25712080-25712102 GTGTTCTAATTGTGGAAAGTAGG - Intergenic
1022450087 7:30505871-30505893 TTGTTCTAATTTTGGCCAGTGGG - Intronic
1023888894 7:44378942-44378964 TTGTTGTAATATTGAGAAATTGG + Intergenic
1027555000 7:79653062-79653084 TTGCTGGCATGTTGGAAATTTGG - Intergenic
1028166504 7:87543655-87543677 TTGTTTTAATCTTAGCAAGTGGG + Intronic
1029920258 7:104254874-104254896 TTATTTTAATGTTGAAAGGTGGG + Intergenic
1030782040 7:113612774-113612796 TTGTTGTAATGATGGGATGAGGG - Intergenic
1031617001 7:123893770-123893792 TTTTTGAAATGTTCAAAAGTTGG - Intergenic
1034174135 7:149087414-149087436 TTGTTATAATGTGGGGAAGCGGG + Intronic
1035084836 7:156249201-156249223 TTGTTCTGAGGATGGAAAGTTGG + Intergenic
1035409940 7:158631522-158631544 TTGTGGGAATGTGGGAAGGTGGG - Intronic
1036808380 8:11850723-11850745 TTTTTGTACTGATGGAAACTGGG + Intronic
1036938367 8:13027039-13027061 TTGTTGAAAGGTTGAAGAGTTGG - Exonic
1037174009 8:15926047-15926069 ATGGTGGAATGTTGGAAGGTCGG - Intergenic
1038719959 8:30026704-30026726 TTGTTGTAAGTTTTGAAATTGGG - Intergenic
1039209908 8:35202210-35202232 TTGATGTTATGTTGGAAAAGGGG + Intergenic
1039839327 8:41282207-41282229 GTTTTGTAATGTTAGAAATTAGG + Intronic
1039860585 8:41453745-41453767 TTCTTTTAATTCTGGAAAGTAGG + Intergenic
1041949278 8:63482396-63482418 ATGTTTTAATGCTGGTAAGTAGG - Intergenic
1042296939 8:67230024-67230046 CTGTTGTGATGGTGGAAGGTTGG + Intronic
1042413657 8:68493894-68493916 TTGTTACAATTTTGGAAACTGGG - Intronic
1043656298 8:82672273-82672295 TTATTAAAATGTTAGAAAGTAGG + Intergenic
1043828855 8:84963446-84963468 TTTTTGGAATGTTGTACAGTGGG - Intergenic
1044512939 8:93104772-93104794 TTGTTGTAAGGTCAGCAAGTTGG + Intergenic
1044800748 8:95951891-95951913 TTGTTTTAATGATGAAAAATAGG + Intergenic
1046279994 8:112015725-112015747 ATGTTGTATTGTTGGCAAATAGG - Intergenic
1046521024 8:115325902-115325924 TGGTGGTAGGGTTGGAAAGTAGG + Intergenic
1046762724 8:118038192-118038214 TTGTTTTAAAGTGGGAAAGGGGG + Intronic
1046856508 8:119038421-119038443 TTATTGTAATTTTGGAAAAAGGG + Intronic
1047052903 8:121132826-121132848 TTGTGATAATGTGGGAATGTTGG - Intergenic
1047146338 8:122203473-122203495 TTGTTGTAAGTTTTGAAATTGGG - Intergenic
1047377903 8:124321058-124321080 TTACTTTAATGTTGGAAACTGGG + Intronic
1047397537 8:124515508-124515530 TTATTGTAATGGTAGAAATTAGG - Intronic
1048016715 8:130503744-130503766 CTGTTATAATTTTGGAAAGGTGG + Intergenic
1050159626 9:2703854-2703876 TTGGTGAAATGTGGAAAAGTAGG + Intergenic
1051614692 9:18995907-18995929 TTGTTGTATTTTTGGTAAGATGG - Intronic
1052658357 9:31394929-31394951 TAGTTGTAGTGTTGAAAAATGGG - Intergenic
1053831236 9:42083710-42083732 TTGTTGTAAGGGTGGAAATGAGG - Intronic
1053977487 9:43843927-43843949 TTTTTGTAATATTTGGAAGTGGG + Intergenic
1054077642 9:60555681-60555703 TTTTTGTAATATTTGGAAGTGGG - Intergenic
1054083047 9:60648033-60648055 TTTTTGTAATATTTGGAAGTGGG - Intergenic
1054084110 9:60666397-60666419 TTTTTGTAATATTTGGAAGTGGG - Intergenic
1054599311 9:67103728-67103750 TTGTTGTAAGGGTGGAAATGAGG + Intergenic
1055362613 9:75509909-75509931 TTTCTGTACTATTGGAAAGTGGG + Intergenic
1056869328 9:90262587-90262609 CTGTTGTAATTTTGCAAAGGTGG + Intergenic
1057261035 9:93584414-93584436 TTTTTGTAATGATGGAAGGTAGG + Intronic
1057336475 9:94159549-94159571 ATATTGTCATGTTGGAATGTAGG + Intergenic
1058238698 9:102527842-102527864 TTATTGTATTCTTGGAAACTTGG + Intergenic
1058809177 9:108622765-108622787 TGGTTGGATTGTTGGAAAGTTGG - Intergenic
1058934922 9:109761331-109761353 TTGTTGTAATGTCTGAAACAAGG + Intronic
1059395124 9:114029394-114029416 TCGTTGTCCTGTAGGAAAGTGGG - Intronic
1059781686 9:117535433-117535455 CTGTTGAAATGTTGGAAGATAGG - Intergenic
1060990900 9:127848292-127848314 TTTTTTTAATTTTGGAGAGTCGG + Intronic
1185920499 X:4086816-4086838 TTGTGGCAATGTTGGGAGGTGGG + Intergenic
1186675869 X:11816778-11816800 TTTTAGTCAAGTTGGAAAGTCGG + Intergenic
1186712881 X:12218832-12218854 TAGCTGTTATGTTTGAAAGTAGG - Intronic
1186984105 X:14992844-14992866 GTGATGTAATGTTGGGGAGTGGG - Intergenic
1187329286 X:18321490-18321512 TTGTTTTATTGATGGAAAATAGG - Intronic
1187460252 X:19480368-19480390 TTGTAGTAATTTTTGAAATTTGG - Intronic
1188305479 X:28556397-28556419 TTGTTTTAATTTTGGGGAGTGGG - Intergenic
1188527095 X:31098555-31098577 TATTTATAATGTTGGAAAATTGG - Intronic
1188804187 X:34567692-34567714 TTTTTATAATGGTGAAAAGTAGG + Intergenic
1188845073 X:35062199-35062221 TTGTAGTTATGTTAGAAAGAAGG - Intergenic
1189773431 X:44448785-44448807 ATGTTCAAATGTTGGAAACTAGG - Intergenic
1191637762 X:63396051-63396073 TTGTAGTAATTTTTGAAATTAGG + Intergenic
1192128056 X:68520917-68520939 TTGTTGCAGTGTTGGAATGCAGG + Intronic
1192506663 X:71689795-71689817 GTGTGGTGATGTTGGAAGGTGGG - Intergenic
1192520034 X:71791751-71791773 GTGTGGTGATGTTGGAAGGTGGG + Intergenic
1194816282 X:98446045-98446067 TTGGAGTAATGGTGAAAAGTAGG - Intergenic
1195436631 X:104852001-104852023 ATGTGGCAGTGTTGGAAAGTGGG - Intronic
1195627179 X:107016293-107016315 ATGTTGTAATTTTTGAAACTAGG + Intergenic
1195692769 X:107641693-107641715 TTGGGTTTATGTTGGAAAGTAGG - Intronic
1196375835 X:115031519-115031541 TGGTTGTAATATTTGCAAGTGGG - Intergenic
1196685407 X:118506081-118506103 TTGTTTTAATTTTGTAAAGATGG - Intronic
1197089251 X:122517327-122517349 TTGTAGTATTGTTTGAAACTGGG - Intergenic
1197725156 X:129771281-129771303 TTGTTTTAATGTTGGAGGATGGG + Intergenic
1198184871 X:134243999-134244021 TTTTTATAAACTTGGAAAGTTGG + Intronic
1198193588 X:134336535-134336557 GTGTGGCAATGTTGGCAAGTGGG - Intergenic
1202053773 Y:20807825-20807847 TTGTGATAGTGTTGGGAAGTAGG + Intergenic