ID: 992924135

View in Genome Browser
Species Human (GRCh38)
Location 5:81563781-81563803
Sequence ATGTTTCTCTAGTAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992924135_992924137 0 Left 992924135 5:81563781-81563803 CCATAAAACTACTAGAGAAACAT 0: 1
1: 0
2: 4
3: 36
4: 407
Right 992924137 5:81563804-81563826 GAGGAAAAGCTTCGTGACATTGG 0: 2
1: 16
2: 112
3: 405
4: 1135
992924135_992924138 18 Left 992924135 5:81563781-81563803 CCATAAAACTACTAGAGAAACAT 0: 1
1: 0
2: 4
3: 36
4: 407
Right 992924138 5:81563822-81563844 ATTGGTTAGCAATGATTTCATGG 0: 1
1: 0
2: 1
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992924135 Original CRISPR ATGTTTCTCTAGTAGTTTTA TGG (reversed) Intronic
904204622 1:28845679-28845701 ATTTTCTTCTAGGAGTTTTATGG + Intronic
905685899 1:39908019-39908041 CTGTTTCTCTGGTAGCTTTTAGG + Intergenic
906583969 1:46959740-46959762 ATTTTATTCTAGTAGTTTTATGG - Intergenic
906856547 1:49312382-49312404 ATTTATTTCTTGTAGTTTTAGGG - Intronic
907878055 1:58514340-58514362 ATATTTCTCTAGTATTGTTTTGG - Intronic
907970506 1:59376445-59376467 GTGTTTATATAGTAGTGTTAGGG + Intronic
908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG + Intergenic
909404361 1:75270560-75270582 ATATTTCTCTAGTATTTTGATGG - Intronic
909404508 1:75272495-75272517 GTTTTTTTCTAGAAGTTTTATGG + Intronic
909427382 1:75541952-75541974 TTGTTTCTGTTTTAGTTTTAGGG + Intronic
909734095 1:78934439-78934461 ATTTTCTTCTAGGAGTTTTATGG - Intronic
909821908 1:80074440-80074462 AATTTTATCTAGTATTTTTATGG + Intergenic
909926023 1:81439041-81439063 AAGGTTCTCTGGGAGTTTTACGG - Intronic
910275288 1:85443131-85443153 GTTTTTCTCTAGGATTTTTATGG + Intronic
910279811 1:85486937-85486959 ATTCTTCTCTATTAGTTTCAGGG - Intronic
910929324 1:92427290-92427312 ATGTTCTTCTAAGAGTTTTATGG - Intergenic
911452513 1:98082033-98082055 TTTTTTTTCTAGTACTTTTATGG + Intergenic
911603754 1:99876714-99876736 ATGTATCTCTGGTACCTTTATGG - Intronic
911808890 1:102247788-102247810 ATTTTTCTCTAAAAGTTTCAAGG + Intergenic
911904919 1:103554590-103554612 AGGTTTCTTTAGTAATTTTAAGG + Exonic
912072774 1:105833512-105833534 GTTTTCCTCTAGAAGTTTTATGG - Intergenic
913285848 1:117225690-117225712 ATTTTCTTCTAGTACTTTTACGG - Intergenic
913466167 1:119145137-119145159 GTCTTTCCCTAGTAGTTTTTGGG + Intergenic
914049431 1:144119346-144119368 ATGCTGCTCCACTAGTTTTATGG - Intergenic
914129753 1:144846094-144846116 ATGCTGCTCCACTAGTTTTATGG + Intergenic
914337917 1:146732598-146732620 ATGTTGATCTACCAGTTTTAAGG + Intergenic
914843952 1:151270323-151270345 ATGTTTCTTTAGAATTTTGAAGG + Intergenic
914977993 1:152384006-152384028 GTGTTCTTCTAGTAGCTTTATGG + Intergenic
915986059 1:160465996-160466018 TTTTTTTTCTAGTAGTTTTATGG + Intergenic
916238621 1:162615854-162615876 ATTTTTCTTTAGGAGTTTAATGG + Intergenic
916272251 1:162955895-162955917 ATGTTTCTGTAGTACCTTGAGGG - Intergenic
916511791 1:165478686-165478708 ATGTTATTTCAGTAGTTTTAGGG - Intergenic
916829060 1:168472654-168472676 ATGTTTCTTTTCTATTTTTAAGG + Intergenic
917911408 1:179650735-179650757 GTGTTATTCTAGTACTTTTATGG + Intronic
918084420 1:181233184-181233206 ATTTTTTTCTACTAGTTTCATGG - Intergenic
919199655 1:194339070-194339092 ATACTTCTCTGGTACTTTTACGG - Intergenic
919573972 1:199283565-199283587 TTATTTCTCTAGAAGGTTTAGGG - Intergenic
920903885 1:210140606-210140628 GTTTTCTTCTAGTAGTTTTATGG + Intronic
921102187 1:211938491-211938513 ATGTTTCTCTATTAGGAATAAGG + Intergenic
921307265 1:213809321-213809343 ATGTTACTATAGTAATTTTGAGG - Intergenic
921327703 1:214003814-214003836 ATGCTTCTCTAGTAACTTTCTGG + Intronic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
922649637 1:227326551-227326573 ATGATTATCTAGTAGTTTTGTGG - Intergenic
923175401 1:231459084-231459106 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
923276623 1:232402318-232402340 ATTTATCTGTAGTAGTTATAAGG + Intronic
1062778857 10:182098-182120 ATGTTTCTCTAGAAGCTTTAGGG + Intronic
1063046516 10:2398082-2398104 CTGCTTCTGTAGTAGCTTTAAGG - Intergenic
1066115970 10:32240344-32240366 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1066667655 10:37801576-37801598 ATTTTTCTATATTATTTTTAAGG - Intronic
1066748602 10:38629368-38629390 ATTTTCTACTAGTAGTTTTATGG - Intergenic
1067074115 10:43163429-43163451 CTGCTTCTCAAGTAGTATTAGGG + Intronic
1067997745 10:51294321-51294343 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1068340872 10:55700398-55700420 ATGCTTCCCTGGTAATTTTAAGG - Intergenic
1068722974 10:60267475-60267497 ATGTTATTTTTGTAGTTTTAAGG - Intronic
1070608737 10:77918607-77918629 ATGTTTCTGTAGCACTTTTGTGG + Intronic
1071283988 10:84127476-84127498 ACTTTTCTCTGGTAGTTTGATGG - Intergenic
1073437070 10:103524549-103524571 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1074288153 10:112118014-112118036 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG + Intergenic
1076939863 10:133596526-133596548 TTGTTTTTCTAGTTGTTTAAAGG + Intergenic
1077682557 11:4256744-4256766 ATTTTCTTCTAGTAGTTTCATGG + Intergenic
1077687476 11:4309994-4310016 ATTTTCTTCTAGTAGTTTCATGG - Intergenic
1077692643 11:4361183-4361205 ATTTTCTTCTAGTAGTTTCATGG - Intergenic
1078010189 11:7567194-7567216 ATCTTCCTCTAGTAAGTTTATGG + Intronic
1078034413 11:7788051-7788073 ATTTTCCTCTAGGAGTTTTACGG - Intergenic
1080990316 11:37526075-37526097 TTGTTTCTCTAGTTTTTCTAGGG + Intergenic
1081099195 11:38981220-38981242 ATTTTTTTCTAGGAGATTTATGG - Intergenic
1081155730 11:39687321-39687343 ATGTTAGTCTAGCAGTTTTAGGG + Intergenic
1081177730 11:39949100-39949122 ATGTATATCTTGTTGTTTTAGGG - Intergenic
1081749261 11:45496754-45496776 CAGTTTCTCTAATAGATTTAGGG + Intergenic
1082873000 11:57960985-57961007 ATGAGGCTCTAGCAGTTTTAGGG - Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1087392944 11:97562022-97562044 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1087707226 11:101507202-101507224 ATTTTTATCTATTAGGTTTAAGG - Intronic
1088308830 11:108438591-108438613 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1088491661 11:110394430-110394452 GTTTTCCTCTAGTAGTTTCATGG + Intergenic
1091990912 12:4955244-4955266 ATGTTTTTCTATTAGTTCTTAGG + Intergenic
1092452984 12:8620362-8620384 ATTTTCTTCTAGTAGTTTTACGG + Intergenic
1092587530 12:9914750-9914772 ATTTTTTTCTAGGGGTTTTATGG - Intronic
1093108834 12:15123813-15123835 TTGTTGCTCCAGAAGTTTTAAGG + Intronic
1093152712 12:15642152-15642174 ATCTTTATCTAGTTCTTTTATGG - Intronic
1093306851 12:17531002-17531024 ATTTTCTTCTAGTAGTTGTATGG + Intergenic
1093360069 12:18214299-18214321 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1094010844 12:25807936-25807958 ATGCTTCTCTACTATTTCTATGG - Intergenic
1094046555 12:26173909-26173931 TTCCTTGTCTAGTAGTTTTATGG - Intronic
1094268260 12:28583301-28583323 ATGTTTATCTAGTATTTCTAGGG - Intergenic
1094324329 12:29220447-29220469 ACGTTTCTCTATTAATTTAATGG + Intronic
1095449631 12:42316399-42316421 CTGTTTCTTAAGTATTTTTATGG + Intronic
1095670415 12:44853356-44853378 ATGTTTCACTATTATTTTGAAGG - Intronic
1095847981 12:46767744-46767766 TTGTTTCTATAGTAGTCTTATGG + Intronic
1096045840 12:48561411-48561433 ATATTTCTCTTGTAGTGTGATGG - Intergenic
1096327037 12:50672906-50672928 ATGTTACACTATTATTTTTATGG + Intronic
1096948687 12:55440626-55440648 CTGTTCCTCTAGTAATTGTAAGG - Intergenic
1096965328 12:55622524-55622546 ATGTTTCTTTAGAATTTCTAAGG - Intergenic
1097596433 12:61638128-61638150 ATCTTTCTCTTCTACTTTTAAGG - Intergenic
1098654215 12:73007861-73007883 ATGTTCTTATAGTATTTTTATGG + Intergenic
1098852492 12:75613691-75613713 TTGTTTCTCTAGTTTTTTTGAGG - Intergenic
1099391708 12:82088627-82088649 ATTTTCTTCTAGTATTTTTATGG - Intergenic
1100107897 12:91199680-91199702 ATGTCACTCTGGTAGCTTTATGG - Intergenic
1101942212 12:109108085-109108107 ATGTTTTTCTAGGAGTTATGTGG + Intronic
1103798726 12:123523325-123523347 ATGTTTCTCTGGCAGGGTTATGG + Intronic
1105234053 13:18529642-18529664 ATATTTACCTAATAGTTTTATGG - Intergenic
1105964919 13:25374827-25374849 ATCTTTGTTTAGTATTTTTATGG - Intronic
1106963657 13:35033109-35033131 GTGTTTTTATAGTAGTTTCATGG + Intronic
1106984911 13:35334959-35334981 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1107179303 13:37439956-37439978 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1107754732 13:43608085-43608107 ATGTTTCTAAAGTATTTTTCAGG - Intronic
1107832872 13:44390073-44390095 CTGTTTCCCTAGAAGTTGTATGG + Intronic
1108355270 13:49624351-49624373 ATGTTTCTCTAGCACTTTCCAGG + Intergenic
1108866133 13:54924987-54925009 TTTTTTTTCTAGTAGTTTTATGG + Intergenic
1109394298 13:61735157-61735179 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1109485540 13:63014435-63014457 CTTTTTCTCTAGAAGTTTTGTGG + Intergenic
1110191294 13:72732023-72732045 ATTATTCTTTTGTAGTTTTAGGG + Intronic
1110726064 13:78825321-78825343 GTATTTTTCTAGTATTTTTATGG + Intergenic
1110801444 13:79701375-79701397 ATCTTTCTATATTAGTTTTACGG - Intergenic
1111220690 13:85201951-85201973 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1111943068 13:94633800-94633822 ATTTTCATCTAGTGGTTTTATGG + Exonic
1112456453 13:99567479-99567501 ATGTGTCTTAAGAAGTTTTAAGG - Intergenic
1115042688 14:28950422-28950444 ATGTGTCAATAGTAGTTTAATGG + Intergenic
1115525612 14:34277504-34277526 ATATTTCTCTAGAAGGGTTAGGG - Intronic
1116205917 14:41866151-41866173 GTTTTTATCTAGAAGTTTTATGG + Intronic
1116212909 14:41970811-41970833 ATTTTTCTCTATAATTTTTATGG + Intergenic
1116321043 14:43463317-43463339 ATTTTTTTCTGGTAGTTTCATGG + Intergenic
1116788753 14:49317101-49317123 ATCTTTCTCTAGTTTTATTATGG - Intergenic
1117848741 14:59943257-59943279 CTTTTCTTCTAGTAGTTTTATGG + Intronic
1117894400 14:60465726-60465748 ATCTTTTTCTATTATTTTTAGGG + Intronic
1118856466 14:69627178-69627200 ATGTTGCTCTAGTATTTATCTGG + Intronic
1123419309 15:20118582-20118604 ATGCTGCTCCACTAGTTTTATGG - Intergenic
1123446557 15:20334921-20334943 ATGCTGCTCCACTAGTTTTATGG + Intergenic
1123510794 15:20997333-20997355 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123528531 15:21125124-21125146 ATGCTGCTCCACTAGTTTTATGG - Intergenic
1123568014 15:21571090-21571112 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1123604122 15:22006414-22006436 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1126654513 15:50962260-50962282 ATGGTTCTCTACAAATTTTAGGG - Intronic
1126724378 15:51616595-51616617 ATATTTCAGTAGAAGTTTTAGGG - Intronic
1126882444 15:53113830-53113852 ATATTTAGCAAGTAGTTTTATGG - Intergenic
1127864255 15:63019042-63019064 ATGTATCTCTAGTAGTTGTGAGG - Intergenic
1128593445 15:68923303-68923325 ATTTTTCTCTTAAAGTTTTATGG + Intronic
1128630359 15:69259447-69259469 TAGTTTCTCTGATAGTTTTATGG + Intronic
1128838494 15:70830644-70830666 ACATTTCTCTTGTAGTTTTTGGG + Exonic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1129489604 15:75910868-75910890 ATGTTCTTCTAGTGTTTTTATGG + Intronic
1131764695 15:95662618-95662640 ATCTTTCTCTAGGAGATTCATGG + Intergenic
1131914018 15:97242359-97242381 GTTTTTCCCTAGGAGTTTTATGG + Intergenic
1202976373 15_KI270727v1_random:298180-298202 ATTTCTTTCCAGTAGTTTTAAGG - Intergenic
1134591602 16:15458769-15458791 ATGTTTCCTTAGTAGTTCTGAGG - Intronic
1135245895 16:20856781-20856803 ATGTTTCTTTAGCAGTTTATTGG - Exonic
1135602793 16:23797465-23797487 ATGTTTCTCAAGTATTTCAAAGG + Intergenic
1135700850 16:24631249-24631271 AGGTTTCTCAAGCAGTTGTAGGG - Intergenic
1138075121 16:54034634-54034656 CTGTTCTCCTAGTAGTTTTAGGG + Intronic
1139072503 16:63400194-63400216 GTTTTACTCTAGGAGTTTTATGG - Intergenic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1139996361 16:70984737-70984759 ATGTTGATCTACCAGTTTTAAGG - Intronic
1140333993 16:74086262-74086284 CTTTTCTTCTAGTAGTTTTACGG + Intergenic
1142783076 17:2197027-2197049 ATTTTTTTCTAAGAGTTTTATGG - Intronic
1143492706 17:7293675-7293697 AGGTTTCACTAGTAGCTTCAAGG + Intronic
1145740870 17:27273356-27273378 ATGTTCTTCTATTACTTTTATGG - Intergenic
1146736999 17:35246941-35246963 ATTTTTCTCTAGAAATTTTATGG + Intronic
1146984944 17:37206879-37206901 GTGTTTCTCTTGTATTTTTTAGG - Exonic
1147483389 17:40788614-40788636 ATTTTCTTCTAGTACTTTTAAGG - Intergenic
1149618976 17:58027536-58027558 CTTTTTGTATAGTAGTTTTAGGG - Intergenic
1152326293 17:79640840-79640862 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1153439100 18:5097627-5097649 ATTTTTCTGAAGAAGTTTTAGGG - Intergenic
1153561782 18:6378423-6378445 GTTTTTGTCTAGTATTTTTATGG + Intronic
1153855415 18:9139946-9139968 CTCTTTCTTTAGAAGTTTTACGG + Intronic
1153924343 18:9822341-9822363 AAGTTTTTCTAAAAGTTTTATGG - Intronic
1154515486 18:15160242-15160264 ATATTTACCTAATAGTTTTATGG + Intergenic
1156233343 18:35176529-35176551 AAATTTCTTTAGTAGTTATAGGG - Intergenic
1156427342 18:37028407-37028429 TTGTTTATCTAGGAGCTTTAGGG + Intronic
1158162259 18:54498575-54498597 TTTTTTTTCTAGGAGTTTTATGG + Intergenic
1158657687 18:59354754-59354776 TTGTTTCTCTATTAATTTTCAGG - Intronic
1160428281 18:78793266-78793288 TTGTTTCTATTTTAGTTTTAGGG - Intergenic
1160580305 18:79879943-79879965 TTGTTTCTCCTGAAGTTTTATGG - Intronic
1168446293 19:56417744-56417766 ATATTTTTCTAGGAGTTTTAAGG + Intronic
925938901 2:8796085-8796107 TTGTTTTTCTATTAGTTATAAGG - Intronic
926346319 2:11949200-11949222 GTTTTTCTCTAGAAGTTTTATGG - Intergenic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
926920550 2:17935842-17935864 ATGTTTAACTCGGAGTTTTAGGG + Intronic
926995856 2:18735193-18735215 ATTTTCTTCTAGGAGTTTTATGG - Intergenic
927023012 2:19037087-19037109 ATATTTCTTGAATAGTTTTATGG - Intergenic
927166417 2:20327546-20327568 ATGTTTTTCTACAGGTTTTAAGG - Intronic
927299290 2:21492531-21492553 ATGTTCCTCTTCTAGTTGTATGG + Intergenic
927766254 2:25811338-25811360 ATGTTTCTTTGGTGGTTTTTGGG - Intronic
928279563 2:29933014-29933036 ATTTTCCTCTAGTGATTTTATGG + Intergenic
929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG + Intronic
932627659 2:73311330-73311352 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
933068244 2:77825906-77825928 GTTTTTCTTTAGTAGTTTTATGG + Intergenic
933957616 2:87384185-87384207 ATGCTGCTCCACTAGTTTTATGG + Intergenic
934241736 2:90276080-90276102 ATGCTGCTCCACTAGTTTTATGG + Intergenic
934271436 2:91540605-91540627 ATGCTGCTCCACTAGTTTTATGG - Intergenic
934311581 2:91871495-91871517 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
935507081 2:103918971-103918993 TTGTTTTTCTGTTAGTTTTATGG + Intergenic
936471220 2:112800263-112800285 ATTTTCTTCTAGTAATTTTATGG - Intergenic
936706677 2:115083467-115083489 AGGTTTCTCTAGTAGGTTGCTGG - Intronic
937813338 2:126222858-126222880 ATGTTTTTCTAGTCCTTTTATGG + Intergenic
939392657 2:141588804-141588826 ATGTTACTCTAGTAATTATGTGG + Intronic
939411866 2:141837877-141837899 ATATTTCTCTGGGAGTTTGATGG - Intronic
940172111 2:150840435-150840457 TTGTTTCTCTAGTTCTTTGAGGG + Intergenic
941555055 2:166967939-166967961 TTGTTTATATAGAAGTTTTATGG - Intronic
941738801 2:169010732-169010754 ATGTTTGTTTAGCTGTTTTATGG - Intronic
942348023 2:175023303-175023325 ATTTTATTCTAGTACTTTTACGG + Intergenic
942350075 2:175043142-175043164 ATTTTTTTCTAGGATTTTTACGG + Intergenic
943421080 2:187670290-187670312 ATGTTTCTTTGGTAATTTAAAGG - Intergenic
943891542 2:193293260-193293282 TTGTTCTTCTAGAAGTTTTATGG - Intergenic
944475846 2:200105187-200105209 ATTTTATTCTAGTACTTTTACGG + Intergenic
944888327 2:204088540-204088562 ATGTTTGTTTAGTAATTTTATGG + Intergenic
945356482 2:208845464-208845486 ATATTTCTTTGCTAGTTTTATGG - Intronic
945673345 2:212828280-212828302 ATTCTTCTCTAGAATTTTTAAGG + Intergenic
946978463 2:225179628-225179650 CAGTTTTTCTAGTGGTTTTATGG + Intergenic
1168735172 20:128971-128993 GTCTTCTTCTAGTAGTTTTATGG + Intergenic
1169185058 20:3608311-3608333 ATTTTCTTCTAGTAGTTTTATGG + Intronic
1170721540 20:18884481-18884503 ATTTTCTTCCAGTAGTTTTAAGG + Intergenic
1171116371 20:22528160-22528182 ACATTTCTCTACTAGTTTTCTGG + Intergenic
1171190051 20:23152276-23152298 ATCTTTTCCTAGTATTTTTATGG - Intergenic
1171515644 20:25730914-25730936 ATTTTCCTGTAGTATTTTTAGGG + Intergenic
1174930521 20:54808952-54808974 ATGTTCCTCCAGAACTTTTAAGG + Intergenic
1177437593 21:21076210-21076232 TTTCTTCTCTAGTACTTTTATGG + Intronic
1177464346 21:21456637-21456659 ATTTTCTTCTAGTAGATTTATGG - Intronic
1177733524 21:25059848-25059870 AATTTTCTCTAGTAGAATTACGG + Intergenic
1177975657 21:27846913-27846935 ATATTTACCTAATAGTTTTATGG - Intergenic
1178073925 21:28998334-28998356 ATATTCCTCTAGTACTATTATGG - Intergenic
1178211563 21:30540122-30540144 ATGTTTTTGTAGTAGCTTTCAGG - Intergenic
1179263767 21:39783824-39783846 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1180031872 21:45215985-45216007 ATTTTTCTATAATAGATTTAGGG + Intronic
1180538331 22:16417307-16417329 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1180552606 22:16552683-16552705 ATGCTGCTCCACTAGTTTTATGG + Intergenic
1181088099 22:20453260-20453282 CTTTTTTTCTAGAAGTTTTATGG + Intronic
1181351428 22:22261349-22261371 ATGCTGCTCCACTAGTTTTATGG - Intergenic
1181940405 22:26471387-26471409 ATGCTTTTCTTGTATTTTTAGGG - Intronic
1182967895 22:34540057-34540079 GTTTTTCTCTAGAAATTTTATGG + Intergenic
1183644385 22:39115194-39115216 ATGTTTCTTTCAGAGTTTTAGGG + Intergenic
949210389 3:1491925-1491947 ATTTTTATTTAGGAGTTTTATGG + Intergenic
949306365 3:2646106-2646128 ATTTTTCTCTTTTGGTTTTAAGG - Intronic
949748986 3:7329159-7329181 ATGTTCCTCTAGTGATTTTGTGG - Intronic
950191332 3:10978458-10978480 CTGTTTCTCTGGCAGTTTTGGGG - Intergenic
950695288 3:14696017-14696039 TTGTTTCTCTGGTTGTTTTGTGG + Intronic
950785904 3:15435366-15435388 ATGTTTCCCTACTATTATTATGG - Intronic
950825954 3:15821629-15821651 ATGTTCCTCTGGTTGTTATAAGG - Intronic
951125024 3:18974278-18974300 TTTGTTCTCTAGTTGTTTTATGG + Intergenic
951356470 3:21672895-21672917 ATTTTTCTCTAGTATGTTTCAGG - Intronic
952025635 3:29077939-29077961 TTGTTTCTCTAGTACTTTGTAGG - Intergenic
952595207 3:35009246-35009268 ATATTCCTCTAGGAGTTTTCTGG - Intergenic
952624356 3:35386260-35386282 ATTTTTCTCTAAAAGTTTAAAGG - Intergenic
952861065 3:37812549-37812571 TTGTTTCCCTAGGAGTTTTCTGG + Intronic
953280701 3:41553139-41553161 ATTTTTTTCTAGTAATATTATGG - Intronic
954279446 3:49565672-49565694 ATGTACCTCTAGTAGTTAGAGGG + Intronic
954944300 3:54405603-54405625 ATTTTCTTCTAGCAGTTTTATGG - Intronic
955522607 3:59789663-59789685 TTGTTTTTCTAGTCTTTTTAGGG + Intronic
955784208 3:62519221-62519243 ATGTTCCAATAGAAGTTTTATGG - Intronic
955992100 3:64639009-64639031 ATGCTTCTCAAGGAGTTTGAGGG - Intronic
957352583 3:79045455-79045477 ATGTTTCTCTATAATTATTAAGG - Intronic
957429118 3:80078536-80078558 ATTTTTCACTAGAAGTTTAATGG + Intergenic
957809888 3:85207608-85207630 ATTTTTATCTAGTGGTTTAATGG + Intronic
957890974 3:86357027-86357049 AAGTTTAACTAGTAGTTTTAAGG + Intergenic
959041460 3:101426934-101426956 TTGTTTCTGTAGTTGCTTTATGG - Intronic
959413386 3:106053408-106053430 ATTATTTTCTAGGAGTTTTATGG - Intergenic
959957932 3:112260284-112260306 ATTTTTCTTTAGTTTTTTTATGG + Intronic
960091569 3:113645247-113645269 GTGTTTCTCTTTTAGTTTTTAGG + Intergenic
960248839 3:115429842-115429864 ATGTATTTCCAGTAGTTTTTTGG - Intergenic
960443987 3:117724818-117724840 ATTTTTCTCTAGTATTTATGTGG - Intergenic
960547308 3:118930463-118930485 ATTTTTCTATTGTAGTTTTCAGG - Intronic
960654931 3:119992499-119992521 ATTTTCCTCTAGTAGTTATCAGG - Intronic
961963358 3:130876229-130876251 GTTTTCTTCTAGTAGTTTTAGGG + Intronic
962147488 3:132855632-132855654 ATGTTCCTGTGGTAGTTTTTGGG + Intergenic
962811914 3:138966308-138966330 AAGTTTTTCTAGTCCTTTTAAGG + Intergenic
963457228 3:145559427-145559449 ACTTTTTTCTAGTAGTTTTATGG + Intergenic
963844699 3:150143444-150143466 AGGTTTTTCTGGTAGTTTTTTGG + Intergenic
965085585 3:164091621-164091643 ATGTTTGTCATATAGTTTTATGG + Intergenic
965345550 3:167544728-167544750 ATGTTCTTCTAGAATTTTTATGG - Intronic
965392855 3:168126950-168126972 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
965432865 3:168611232-168611254 TTCTTTCTTTAGGAGTTTTATGG - Intergenic
966479145 3:180385635-180385657 ATCTTCCTCTAGAAGTTTTTGGG - Intergenic
966694243 3:182773276-182773298 GTCTTCTTCTAGTAGTTTTATGG + Intergenic
967769325 3:193316914-193316936 GTTTTCCTCTAGTAGTTTCACGG - Intronic
969165893 4:5312216-5312238 TTGTTTTTCTAGAAGCTTTATGG + Intronic
970880964 4:20930396-20930418 GTTCTTCTCTAGGAGTTTTATGG - Intronic
971005003 4:22363522-22363544 ATGTCTCTCTACTAGTATAATGG + Intronic
971636706 4:29069693-29069715 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
971667114 4:29502216-29502238 ATGATTCTATTGTAGTTTGATGG + Intergenic
971885280 4:32438011-32438033 ATTTTTCTCTATTGGTTTTGTGG + Intergenic
972265756 4:37457977-37457999 ATGTTTTTCTTGTAGACTTAGGG - Intronic
972528390 4:39938619-39938641 ATTTTTCACTTGTAGTTTTTTGG - Intronic
973316451 4:48765535-48765557 TGCTTTTTCTAGTAGTTTTATGG - Intronic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
974830773 4:67186630-67186652 ATCTATCTCTGGTACTTTTAAGG + Intergenic
975597362 4:76061971-76061993 ATGTTTCTGGAATAGTTTGAGGG + Intronic
976090266 4:81449988-81450010 ATGTTTCATTAGTGATTTTAGGG - Intronic
976344813 4:83988492-83988514 ATGTTTCTCTTGTTCTTTAATGG - Intergenic
976462511 4:85329332-85329354 ATGTTTCTCTAATTTATTTAGGG + Intergenic
977433022 4:96956454-96956476 ATTTTTCTCTTCTAGTTTTATGG - Intergenic
978219462 4:106253775-106253797 TTATTTCTCTAGTTGTTTTGGGG + Intronic
979574512 4:122272274-122272296 ATGTTACTCTAATAGTGTTTGGG + Exonic
981083897 4:140662941-140662963 ATTTTCTTCTACTAGTTTTATGG - Intronic
981660573 4:147161648-147161670 AGGTTTTTCTAATAGTTTTCAGG + Intergenic
983950304 4:173631712-173631734 TTTTTTTTCTAGAAGTTTTATGG + Intergenic
983965110 4:173800273-173800295 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
984425371 4:179578448-179578470 ATATTTTTCTATGAGTTTTAAGG - Intergenic
985610887 5:887914-887936 GTCTTTTTCTAGTAGTTTGAGGG - Intronic
986476581 5:8140187-8140209 ATGTTTTTCTAATATGTTTATGG + Intergenic
987187274 5:15436551-15436573 ATGTTTCTCTTCTAGTTTCCAGG - Intergenic
987189132 5:15455710-15455732 ATTTTCCTCTAGTAGTTTCATGG + Intergenic
987240107 5:15988055-15988077 ATTTTCTTCTAGTAGCTTTATGG + Intergenic
987666079 5:20942015-20942037 TTCTTTCTGTAATAGTTTTATGG - Intergenic
989755281 5:44944873-44944895 ATTTTTCTCTAAAAGTCTTAGGG - Intergenic
990877653 5:60504313-60504335 CTGCTTCTCTAGTTCTTTTAAGG + Intronic
990925659 5:61019222-61019244 TTGTTTCTTTAGTTGTATTATGG + Intronic
990971642 5:61513580-61513602 ACTTTTTTCTAGCAGTTTTATGG + Intronic
991306882 5:65186351-65186373 ATTATTCTCTAGTTGTTTCATGG + Intronic
991319004 5:65347537-65347559 TTTTTTTTCTAGTAGTCTTATGG - Intronic
991319754 5:65358912-65358934 GTTTTTTTCTAGTAGTTTTAGGG - Intronic
992164273 5:74033294-74033316 GTTTTTTTCTAGTACTTTTATGG - Intergenic
992310271 5:75491034-75491056 TTGCTTCTTAAGTAGTTTTACGG + Intronic
992694563 5:79273415-79273437 ATTTTTCTCTAGCTGTTTTCAGG + Intronic
992703260 5:79362160-79362182 ATGCTTCTCCAGAAGTCTTATGG - Intergenic
992860905 5:80908804-80908826 ATCTTTCTCTAGTAATGTTAGGG - Intergenic
992924135 5:81563781-81563803 ATGTTTCTCTAGTAGTTTTATGG - Intronic
993236800 5:85321138-85321160 GTATTTTTCTAGTAGTTTTATGG - Intergenic
993288835 5:86038618-86038640 ATGATTCTCTATTTTTTTTAAGG - Intergenic
993921818 5:93814710-93814732 ATGTTTCCCCAGTACTTGTATGG + Intronic
994201075 5:96976792-96976814 AAGTTTCTGTAGTAGTTTTTTGG - Intronic
994257851 5:97621337-97621359 TTGTTTTTCTAGTTCTTTTAGGG + Intergenic
994406692 5:99353354-99353376 ATTTTCCTCTATGAGTTTTATGG + Intergenic
994633661 5:102318012-102318034 TTGTTTTTCCAGTTGTTTTATGG + Intergenic
995155672 5:108909936-108909958 ATTTTCTTCTAGTAGTTTTGTGG - Intronic
996156085 5:120103194-120103216 ATGTTTCTCTTGTTGATTTCCGG + Intergenic
997319624 5:132966837-132966859 TTGTTTCTCTTTTAGTTTTATGG - Intergenic
997876657 5:137554904-137554926 ATGTTATTCTAGTGGTTTTATGG - Intronic
998739587 5:145185231-145185253 ATTTTCCTCTAGGACTTTTATGG - Intergenic
1001829909 5:174777285-174777307 AGGTTTTTCTAGTAGTCTTTTGG + Intergenic
1002623114 5:180504321-180504343 AATTTTCTTTTGTAGTTTTAAGG + Intronic
1002942158 6:1726924-1726946 TTCTTTCTTTTGTAGTTTTAGGG + Intronic
1003361204 6:5427295-5427317 GTTTTCTTCTAGTAGTTTTATGG - Intronic
1004122867 6:12842173-12842195 ATGTTTCAATAGAATTTTTAAGG - Intronic
1005391392 6:25337374-25337396 CTGTTTCTTTAGTTGTATTACGG + Intronic
1006197874 6:32258201-32258223 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1007191106 6:40019610-40019632 GTTTTCCTCTAGTAGTTTCAAGG - Intergenic
1007910681 6:45511249-45511271 ATGTATCTCTAGGAGTTTCTTGG - Intronic
1008679025 6:53852798-53852820 CTTATTCACTAGTAGTTTTATGG - Intronic
1008761158 6:54852389-54852411 ATGTTACTCTTGTAATTTTTTGG + Intronic
1009950043 6:70384952-70384974 GTTTTTTTCTAGGAGTTTTATGG + Intergenic
1010328371 6:74591975-74591997 ATGTTTTTGTAGTAGTTTTATGG - Intergenic
1010497583 6:76554033-76554055 ATATTTCTCTAGTGTTTTTTGGG + Intergenic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1010588592 6:77685650-77685672 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1011728789 6:90238267-90238289 ATTTTTCTCTAAGAGTTTCAGGG - Intronic
1011757997 6:90525277-90525299 CTCTTTCTCTAGTAATTTTTTGG - Intronic
1012502738 6:99907419-99907441 ATTTTATTCTAGTAGTTTCATGG - Intergenic
1012913412 6:105142242-105142264 ATTTTCTTCTAGTGGTTTTATGG + Intergenic
1013065350 6:106678991-106679013 ATTTTTGTCTTTTAGTTTTATGG - Intergenic
1013371670 6:109476398-109476420 ATGTTTCTGTGGTAGATTGAAGG - Intronic
1013785811 6:113778810-113778832 ATGTATGTCTAGTAGTTTTGTGG + Intergenic
1014496191 6:122126270-122126292 ATTTTTCTCCATTATTTTTAGGG - Intergenic
1015043407 6:128748798-128748820 ATTTTTCTGTAGCATTTTTAAGG - Intergenic
1016367421 6:143334871-143334893 ATTTCTCTCTAGTGGTTTTCAGG - Intronic
1016608905 6:145965551-145965573 ATGTTACTATTGTAGTTTTTTGG + Intergenic
1016798927 6:148148468-148148490 ATAATTCTCTAGTAGTTCAAAGG + Intergenic
1017016305 6:150102999-150103021 GTTTTCTTCTAGTAGTTTTACGG - Intergenic
1017105230 6:150881192-150881214 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1018130199 6:160722757-160722779 ATTTTTCCTGAGTAGTTTTATGG + Intronic
1020500733 7:8916866-8916888 ATGTTTTTCTAAAAGTTTTTCGG - Intergenic
1020512637 7:9077448-9077470 AATTTTATCTAGTATTTTTAGGG + Intergenic
1021160417 7:17265614-17265636 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1021171297 7:17400962-17400984 ATGTTCCTCTAGAATTTTTCAGG - Intergenic
1022342682 7:29483651-29483673 CTGTTTATCTAGTTGATTTAAGG + Intronic
1022888426 7:34671001-34671023 ATGTTTCTTTAGTATACTTATGG - Intronic
1024090099 7:45930332-45930354 ATTTTCTTCTAATAGTTTTATGG + Intergenic
1025062791 7:55825631-55825653 ATGTTTTTTTAGTAGTTTTATGG - Intronic
1025118650 7:56280238-56280260 ATGTTTCTCCAGAAATTTGAGGG - Intergenic
1027186563 7:75975160-75975182 TTTTTTTTCTAGTACTTTTAGGG + Intronic
1027537955 7:79430482-79430504 ATGTTTCTTTAGTAGCTTTATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027955761 7:84877130-84877152 ATCTTTCTCTTCTAGTTTTGAGG + Intergenic
1029333806 7:99882854-99882876 GTTTTCCTCTAGGAGTTTTATGG + Intronic
1030339493 7:108360880-108360902 ATTTTCTTCTAATAGTTTTATGG - Intronic
1030468118 7:109928059-109928081 ATCTTTCTCTAGTATGTTAATGG + Intergenic
1030630454 7:111889648-111889670 ATTTTTCTCTACAAGTTTTCAGG - Intronic
1031618522 7:123908416-123908438 ATGTTTCTCAAGTGATTATAGGG + Intergenic
1031663298 7:124454235-124454257 ATGTTTCTGTGAGAGTTTTAGGG - Intergenic
1033410350 7:141111984-141112006 ATTTGTCTCTAGAAGTATTAAGG + Intronic
1033634544 7:143199463-143199485 CTTTTTCTCTAGAAGTTTTTAGG + Intergenic
1033670008 7:143482762-143482784 TTGTTTTTCTAGAAGCTTTATGG + Intergenic
1036229660 8:6989052-6989074 ATGTTCCTCTCGTCATTTTATGG - Intergenic
1036232111 8:7008155-7008177 ATGTTCCTCTCGTCATTTTATGG - Intronic
1037075709 8:14714715-14714737 ATTTTTTTCTAGTATTTTTCTGG - Intronic
1037478456 8:19280332-19280354 ATTTTACTTTAGTAGCTTTAAGG + Intergenic
1038811488 8:30850700-30850722 TTTTTTTTCTAGTACTTTTATGG - Intronic
1039680056 8:39724619-39724641 TTCTTTTTCTAGTAGTTGTAAGG + Intronic
1039689829 8:39851539-39851561 GTGTTTCCCTAGTTTTTTTAAGG + Intergenic
1041699253 8:60769843-60769865 ATGTTTCTCTGGTTGTATTTTGG + Intronic
1043416422 8:80055448-80055470 GTTTTCTTCTAGTAGTTTTATGG - Intronic
1043618148 8:82153821-82153843 CTATTTTTCTAGGAGTTTTATGG + Intergenic
1044130127 8:88512010-88512032 ATGTTTTCTTAGTAGTTTTATGG - Intergenic
1044872709 8:96635486-96635508 TTTTTTCCCTAGGAGTTTTATGG + Intergenic
1045046535 8:98284374-98284396 ATGTTTTTCAAGTATTTCTAAGG + Intronic
1045458084 8:102401733-102401755 TTGTTTCTGTAGTTGTTTTTTGG - Intronic
1045806758 8:106171337-106171359 TGGTTTGGCTAGTAGTTTTATGG - Intergenic
1045958398 8:107937092-107937114 TTTTTTTACTAGTAGTTTTATGG + Intronic
1046042633 8:108924666-108924688 ACTTTTCTCTAGGAGCTTTAAGG + Intergenic
1046079509 8:109354306-109354328 TTTTTTTTCTAGTGGTTTTATGG - Intergenic
1046256783 8:111709629-111709651 AACTGTCTCTAGTGGTTTTAGGG + Intergenic
1046321288 8:112580324-112580346 ATGTTTCTCTAGTTTGTTTGGGG - Intronic
1046355032 8:113071421-113071443 GTTTTCTTCTAGTAGTTTTATGG + Intronic
1046426476 8:114058391-114058413 ATGATTATCTACTTGTTTTAGGG + Intergenic
1047151875 8:122273358-122273380 ATGCTTCTCTAAAAATTTTAAGG - Intergenic
1050134801 9:2450841-2450863 TTTTTTTTCTAGGAGTTTTATGG + Intergenic
1050616726 9:7408916-7408938 TTCTTTCTCTGATAGTTTTATGG - Intergenic
1051247783 9:15128958-15128980 ATGTGTATCTAGAAGTTTTTTGG - Intergenic
1052869021 9:33485330-33485352 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1055895693 9:81172835-81172857 GTGTTCTTCTAGAAGTTTTATGG + Intergenic
1056326557 9:85484429-85484451 ATTTCCCTCTAGTAGTGTTAGGG - Intergenic
1056707421 9:88963717-88963739 GTTTTCTTCTAGTAGTTTTATGG - Intergenic
1056714215 9:89014753-89014775 ATGTTTCTTTGGTAGGTTGATGG - Intronic
1057045479 9:91882953-91882975 ATATATCTCTATTAGTTTTCTGG - Intronic
1057689375 9:97269733-97269755 GTTTTCTTCTAGTAGTTTTATGG + Intergenic
1058739897 9:107932511-107932533 ATGTTCCTCTAGATCTTTTAGGG - Intergenic
1059056765 9:110991116-110991138 GTTTTCCTCTAGAAGTTTTATGG - Intronic
1060914417 9:127377883-127377905 CTGTTTCTCTTTTAATTTTATGG - Intronic
1062088981 9:134664252-134664274 GTTTTCTTCTAGTAGTTTTATGG - Intronic
1203414756 Un_KI270590v1:613-635 ATGCTTCTCTGTAAGTTTTAGGG + Intergenic
1186090308 X:6039718-6039740 ATGCATCTGTACTAGTTTTAAGG - Intronic
1186650006 X:11549034-11549056 GTTTTCTTCTAGTAGTTTTATGG - Intronic
1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG + Intronic
1187404120 X:18986922-18986944 ATGTTTCTCTTGTAGGGTTCAGG + Intergenic
1187413603 X:19072781-19072803 ATGTTTTTGGAGAAGTTTTATGG + Intronic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1187732676 X:22271671-22271693 ATGTTTTTCTAGTATTTTAGGGG + Intergenic
1188501043 X:30826411-30826433 AAGTTTCTCTAATAGTTTCATGG - Intergenic
1189564207 X:42223241-42223263 ATTTTCTTCTAGTATTTTTATGG + Intergenic
1189863570 X:45299466-45299488 GTTTTTCTCTAAAAGTTTTATGG - Intergenic
1190518474 X:51250238-51250260 TTTTTTTTCTAGGAGTTTTATGG - Intergenic
1190738900 X:53275137-53275159 ATTTTTTTCTGGTACTTTTATGG + Intronic
1190801393 X:53792627-53792649 GTTTTTTTCTAGGAGTTTTATGG + Intergenic
1191769968 X:64744364-64744386 ATTATCTTCTAGTAGTTTTATGG + Intergenic
1191904033 X:66068797-66068819 AAGTTTATATAGTAGTTTTCAGG + Intergenic
1192088023 X:68121026-68121048 GTTTTCTTCTAGTAGTTTTATGG - Intronic
1193737406 X:85175331-85175353 ATTTTCTTCTAGTAGTTATATGG - Intergenic
1193898540 X:87145969-87145991 GTTTTCCTCTAGTCGTTTTATGG - Intergenic
1193986489 X:88247590-88247612 ATATTTCTGTATTAATTTTAGGG + Intergenic
1194102376 X:89721864-89721886 ATGTTTCTCTATTTTTTTTTTGG + Intergenic
1194225244 X:91248621-91248643 ATGTCTTTCTAATAGTTTTTTGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1195054373 X:101128968-101128990 ATGTTTCTGTTGTAATTTTAAGG + Intronic
1195592822 X:106651203-106651225 TTTTATCTCTGGTAGTTTTAAGG - Intronic
1197889459 X:131254287-131254309 TTTGTTCTCTAGTAGTTTTTTGG + Intergenic
1198872525 X:141191120-141191142 TTGTTTATCTAGTTGTTTTGTGG + Intergenic
1198922121 X:141740885-141740907 ATGTTTCTCTTGTAGTTGGAAGG - Intergenic
1199107754 X:143890833-143890855 ATTTTTTTCTAGAATTTTTATGG + Intergenic
1200561713 Y:4711926-4711948 ATGTCTTTCTAATAGTTTTTTGG + Intergenic