ID: 992925195

View in Genome Browser
Species Human (GRCh38)
Location 5:81576566-81576588
Sequence CCAACTAAAAGCTCTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992925192_992925195 8 Left 992925192 5:81576535-81576557 CCTAGGCTTCAGAGTCTGTGTAC No data
Right 992925195 5:81576566-81576588 CCAACTAAAAGCTCTTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992925195 Original CRISPR CCAACTAAAAGCTCTTGACT GGG Intronic