ID: 992934418

View in Genome Browser
Species Human (GRCh38)
Location 5:81687191-81687213
Sequence AGGGAGAGCACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 10, 1: 58, 2: 101, 3: 188, 4: 480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992934411_992934418 10 Left 992934411 5:81687158-81687180 CCGCATGGTACGGAGAATCTGTG 0: 1
1: 0
2: 7
3: 12
4: 103
Right 992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG 0: 10
1: 58
2: 101
3: 188
4: 480
992934406_992934418 28 Left 992934406 5:81687140-81687162 CCGATCACCCGGCAGCGGCCGCA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG 0: 10
1: 58
2: 101
3: 188
4: 480
992934409_992934418 20 Left 992934409 5:81687148-81687170 CCGGCAGCGGCCGCATGGTACGG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG 0: 10
1: 58
2: 101
3: 188
4: 480
992934408_992934418 21 Left 992934408 5:81687147-81687169 CCCGGCAGCGGCCGCATGGTACG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG 0: 10
1: 58
2: 101
3: 188
4: 480
992934405_992934418 29 Left 992934405 5:81687139-81687161 CCCGATCACCCGGCAGCGGCCGC 0: 1
1: 0
2: 2
3: 6
4: 105
Right 992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG 0: 10
1: 58
2: 101
3: 188
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992934418 Original CRISPR AGGGAGAGCACAGTGACTGT GGG Intronic