ID: 992936992

View in Genome Browser
Species Human (GRCh38)
Location 5:81718029-81718051
Sequence CACACCTAGCATCCTAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992936992 Original CRISPR CACACCTAGCATCCTAAGGG CGG (reversed) Intronic
901148871 1:7087135-7087157 CAAACCTAGGACCCTAAAGGCGG - Intronic
910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG + Intergenic
912978932 1:114353299-114353321 CTCACCTAGCATCCTACTGAGGG - Intergenic
915979455 1:160410893-160410915 CATACCCAGCATCCAAAGGGAGG - Intronic
916311876 1:163407073-163407095 CACACCCAGCTTCCACAGGGAGG - Intergenic
917597244 1:176541502-176541524 CACCCCTAGCATCCTTGGGCAGG + Intronic
919797332 1:201329040-201329062 CACCCCTAACGTCCTGAGGGTGG - Intronic
922801132 1:228365237-228365259 AACACCTCTCATCCCAAGGGTGG - Intronic
1063835326 10:10005453-10005475 CACACCCAGCCTCCTTTGGGAGG + Intergenic
1073541300 10:104317989-104318011 CACACTGAGAATCCTCAGGGTGG - Intronic
1076758139 10:132585920-132585942 CACACACAGCACCCTCAGGGTGG - Intronic
1079381231 11:19939370-19939392 TAGACCTAGCATCCTGACGGAGG + Intronic
1083547112 11:63557267-63557289 CACACCTGTAATCCCAAGGGAGG + Intronic
1084777476 11:71387056-71387078 CACACGGAGCATACAAAGGGTGG + Intergenic
1084947744 11:72647752-72647774 CATACAGAGCAGCCTAAGGGTGG - Intronic
1086805678 11:91239428-91239450 AAGACCTAGCATCCTGAGGAAGG - Intergenic
1089833318 11:121348209-121348231 TTCACCTAGCATCCTCAGGGTGG + Intergenic
1090712475 11:129399996-129400018 CACACCTGGAATCCTGAGGTAGG - Intronic
1092184688 12:6470322-6470344 CACAGCTAGCACCCCACGGGCGG - Intronic
1093791556 12:23256250-23256272 CAGACCTATCATCCTCAAGGTGG - Intergenic
1101521868 12:105491117-105491139 CACACCTATAATCCTTTGGGAGG - Intergenic
1103075216 12:117976597-117976619 CACATATAGCACCCTAAGGATGG + Intergenic
1105882865 13:24618784-24618806 CACACCTTTCATATTAAGGGTGG - Intergenic
1124371165 15:29105565-29105587 CACACCCACCAGCCTCAGGGAGG + Intronic
1124451232 15:29793213-29793235 CACAGCTAGTATCATGAGGGGGG - Intronic
1125026734 15:35037915-35037937 CACATTTACCATCCTAAAGGGGG - Intergenic
1132639713 16:972262-972284 CACAGCTGGGCTCCTAAGGGGGG - Intronic
1132731858 16:1366736-1366758 CTCACCTCGCCTGCTAAGGGTGG - Intronic
1134089974 16:11386319-11386341 CAGTCCCAGCATCCTGAGGGAGG + Intronic
1142006218 16:87690694-87690716 CCCACCTGGCTTCCTAGGGGAGG - Intronic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1145963930 17:28903536-28903558 CACACCTAACTTCAGAAGGGAGG - Intergenic
1146156955 17:30532482-30532504 AACACCTAGGAGCCTACGGGGGG + Intergenic
1153419516 18:4888528-4888550 CACAGCTGGTATCCTTAGGGTGG + Intergenic
1158585334 18:58728341-58728363 CACACCTATAATCCTAACAGTGG + Intronic
1158674068 18:59502437-59502459 TACCCCTAACATCCCAAGGGAGG + Intronic
1164258416 19:23549268-23549290 CAGACCTAGCCTGCTAAGGAGGG + Intronic
926697525 2:15781248-15781270 CCCACCTGGCAGCCTAAGGTGGG + Intergenic
929490780 2:42394319-42394341 CACAGCAAACAGCCTAAGGGTGG + Intronic
931692756 2:64849239-64849261 CAGTCCTAGCACACTAAGGGAGG + Intergenic
934502443 2:94871202-94871224 CACACCCTGAACCCTAAGGGTGG + Intergenic
937745577 2:125409050-125409072 CACCACTAACATCCTAAAGGTGG + Intergenic
939546764 2:143564301-143564323 CCCACCTTACATCCTAGGGGAGG + Intronic
940953105 2:159699115-159699137 CACACCCAGTATCCTCAGTGGGG + Intergenic
1172837866 20:37884649-37884671 CACACCTCGCCTCCTCAGAGAGG - Intergenic
1173119956 20:40279616-40279638 CACCCCAAGCAGCCTGAGGGAGG - Intergenic
1174347854 20:49944323-49944345 CACACCTGTAATCCTGAGGGAGG - Intronic
1174502556 20:50996434-50996456 GAAACCTAACATGCTAAGGGTGG - Intergenic
1174624170 20:51900567-51900589 CACGCCTGTCATCCTATGGGAGG + Intergenic
1175221702 20:57421076-57421098 CAAACCTCACCTCCTAAGGGCGG + Intergenic
1176623563 21:9073963-9073985 CACACCCTGAACCCTAAGGGTGG - Intergenic
1180831786 22:18910434-18910456 CACACCTGGCACCCTCAGCGAGG - Intronic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1203281866 22_KI270734v1_random:135705-135727 CACACCTGGCACCCTCAGCGAGG - Intergenic
949861189 3:8506324-8506346 CAAACCAAGCATCCTCAGAGGGG - Intronic
951580332 3:24156555-24156577 CAGTCCTGGCATCTTAAGGGAGG + Intronic
955758228 3:62249127-62249149 CACTCCATGCATCCTAAGAGTGG + Intronic
968018825 3:195365473-195365495 TACACCTACCATCCTGAGGTGGG + Intronic
969205064 4:5637487-5637509 CACACCATGCATGCTAAGGAAGG + Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978337853 4:107688939-107688961 CACACCCACAATCCTAAGAGTGG + Intronic
985004611 4:185521651-185521673 CACACCTATAATCCTTTGGGAGG - Intronic
988520052 5:31937646-31937668 CACAGCTAGCCTTCTATGGGAGG + Intronic
988995709 5:36713162-36713184 CACATCCAGAATCCTGAGGGCGG + Intergenic
989304141 5:39932101-39932123 CACAAATAGCATCATAAAGGTGG + Intergenic
992936992 5:81718029-81718051 CACACCTAGCATCCTAAGGGCGG - Intronic
997481781 5:134190674-134190696 CACACCTAGCTTCCTGAATGGGG + Intronic
998052001 5:139043599-139043621 CACAGCCAGCCTCCAAAGGGAGG + Intronic
999355625 5:150928182-150928204 CAAACCCAGCATCCTATTGGGGG - Intergenic
1000009718 5:157219797-157219819 CACACCTCCCATCTTAAGTGAGG + Intronic
1001396820 5:171423655-171423677 CACACCCAGCCTCCTCAGTGAGG + Intronic
1013426420 6:110017025-110017047 CACACTGAGCAGCCTAAGGCAGG - Intergenic
1015895897 6:138016431-138016453 CACACCTAGCATCCAAATTCTGG - Intergenic
1017947274 6:159105754-159105776 CACACCAAGCAGGCTAAGAGAGG - Intergenic
1019263864 7:101318-101340 CACACCTAGGTTCCTCAGGCAGG - Intergenic
1019635388 7:2072844-2072866 CACACCCTGCATCCTGAGTGAGG + Intronic
1025189261 7:56884220-56884242 TACACCTAGAATCCAAGGGGTGG - Intergenic
1025682679 7:63692697-63692719 TACACCTAGAATCCAAGGGGTGG + Intergenic
1026374179 7:69733701-69733723 CACCACTAGCATCCTTAGTGTGG + Intronic
1030633738 7:111924660-111924682 CACACCTATAATCCTTTGGGAGG + Intronic
1031781670 7:125975626-125975648 CCCACCGAGCATACAAAGGGAGG - Intergenic
1032471324 7:132181377-132181399 CACGCCCATCATCCTAAAGGTGG - Exonic
1035048213 7:155982976-155982998 GACACACATCATCCTAAGGGTGG + Intergenic
1042187834 8:66154563-66154585 CACACCTGGCTTCCCAGGGGAGG + Intronic
1042589079 8:70378184-70378206 CACACCTAGAATTCTTTGGGAGG + Intronic
1049865025 8:144929616-144929638 CACAGGGAGCATCCTAAGGCAGG + Intergenic
1050602596 9:7267753-7267775 AACACCTGGCTTCCTAAAGGAGG - Intergenic
1052664928 9:31483897-31483919 CACTCCTAGCATCCTGGGGCAGG - Intergenic
1060147666 9:121266732-121266754 CCTACCTGGCCTCCTAAGGGAGG - Intronic
1203746747 Un_GL000218v1:44391-44413 CACACCCTGAACCCTAAGGGTGG - Intergenic
1203563357 Un_KI270744v1:75089-75111 CACACCCTGAACCCTAAGGGTGG + Intergenic
1189341835 X:40210384-40210406 CACACCTAGCTTGCAAAGGAGGG - Intergenic
1191634712 X:63363266-63363288 CCCAGCTAGCCTGCTAAGGGAGG - Intergenic
1192320489 X:70086695-70086717 AACACCAAGCATCCCAAGGAGGG + Intergenic
1201160076 Y:11159405-11159427 CACACCCTGAACCCTAAGGGTGG - Intergenic