ID: 992937028

View in Genome Browser
Species Human (GRCh38)
Location 5:81718480-81718502
Sequence TGACCTCTGCTTCCGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992937028_992937032 -9 Left 992937028 5:81718480-81718502 CCTCCTACCGGAAGCAGAGGTCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 992937032 5:81718494-81718516 CAGAGGTCAAGCTGCCGAGGTGG 0: 1
1: 0
2: 0
3: 15
4: 159
992937028_992937033 -8 Left 992937028 5:81718480-81718502 CCTCCTACCGGAAGCAGAGGTCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 992937033 5:81718495-81718517 AGAGGTCAAGCTGCCGAGGTGGG No data
992937028_992937036 27 Left 992937028 5:81718480-81718502 CCTCCTACCGGAAGCAGAGGTCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 992937036 5:81718530-81718552 AAAAACATCCCTACATTCAAAGG 0: 1
1: 0
2: 1
3: 22
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992937028 Original CRISPR TGACCTCTGCTTCCGGTAGG AGG (reversed) Intronic
901828055 1:11875336-11875358 TGGACTCTGCTTCCGATGGGAGG - Intergenic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
908184742 1:61641913-61641935 TGCCTTCTGATTCCTGTAGGTGG - Intergenic
910218828 1:84868744-84868766 TGGTCTCTGCTTCCAGAAGGGGG - Intronic
916172783 1:162013263-162013285 TGACCTCTCCTTCCTGTGAGTGG - Intronic
921126186 1:212180067-212180089 TGACCACTGCTTCCCCTAGCAGG - Intergenic
922763720 1:228147211-228147233 TGGCCTCTGTTCCCTGTAGGCGG + Intronic
1067682735 10:48450818-48450840 GGACCTCGGCTGCCGGAAGGAGG + Exonic
1071422464 10:85514246-85514268 TGAGCTCTGCTTCTGGAAGCAGG - Intergenic
1076204220 10:128582192-128582214 TGACATCTGTTTCCTGAAGGTGG + Intergenic
1091973805 12:4809673-4809695 GGACCTCTGCGTCCGGGAGCCGG + Exonic
1099614101 12:84912879-84912901 TCTCCTCTGCAGCCGGTAGGCGG - Intronic
1101530237 12:105566983-105567005 TGACCTCTCCATCAGGCAGGTGG - Intergenic
1102004383 12:109579928-109579950 ACACCTCTGCTTCCGGCAGATGG - Exonic
1102057983 12:109911044-109911066 CGCCCTCTGCTTCCTCTAGGAGG + Exonic
1119226416 14:72947695-72947717 TGCCCTCAGCTTCCCCTAGGAGG - Intronic
1122247982 14:100417606-100417628 TTACCTCTGCTTGCGGATGGGGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1129083722 15:73066559-73066581 TTACCTTTACTTCTGGTAGGTGG + Intronic
1132230074 15:100175366-100175388 TTCCTTCTGCTTCAGGTAGGAGG + Intronic
1136888412 16:33949651-33949673 GGACTTCTCATTCCGGTAGGTGG + Intergenic
1139211521 16:65082430-65082452 TGACTTCTGCTACTGGTTGGCGG - Intronic
1141212471 16:81994294-81994316 GGTCCTCTCCTTCAGGTAGGAGG + Exonic
1143119154 17:4596573-4596595 TGACCCCTGCTTCCTGGATGGGG + Intronic
1144357566 17:14460662-14460684 TAGCTTCTGCTTCCTGTAGGGGG + Intergenic
1150234673 17:63583440-63583462 TTACCTCTTCTTCCTATAGGAGG - Intronic
1151733999 17:75927529-75927551 TGTCTTCTGCTTCCTGCAGGGGG - Exonic
1151942206 17:77299930-77299952 TGGCCTCTGTTTGGGGTAGGAGG - Intronic
1151949290 17:77340699-77340721 TGACATCTTCTTCCAGTAGAAGG + Intronic
1153823943 18:8857132-8857154 TCTCCTCTGCGTCCGGCAGGCGG + Intergenic
1159744097 18:72210061-72210083 TGTGCTCTGCTTCCAGTTGGTGG + Intergenic
1164390319 19:27814077-27814099 TGTCCTCTGCATCTGGAAGGTGG + Intergenic
1168629821 19:57947842-57947864 TGGCCTTTACTTCCGGAAGGAGG - Intergenic
925254271 2:2468872-2468894 TGACCTCTGCTTGATCTAGGTGG + Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929872040 2:45767197-45767219 ATACCTCTGCTTCTGGAAGGAGG + Intronic
931247790 2:60505694-60505716 TGTCCCCTGCTTCCGGGAGGTGG - Intronic
935575869 2:104709759-104709781 TGTCCTCAGCTTCCAGTTGGAGG + Intergenic
936404485 2:112190214-112190236 TGACAGATGCTTCCAGTAGGAGG + Intergenic
940359229 2:152779580-152779602 TAACCTATACTTCCGTTAGGTGG - Intergenic
943254971 2:185583354-185583376 TGACCTCTACTTCCTGGAGTTGG - Intergenic
945633868 2:212321582-212321604 TGATCTCAGCTTCCAGTAGTTGG - Intronic
945782335 2:214191175-214191197 GGACCCCTGCTTCTGCTAGGTGG - Intronic
946365320 2:219245477-219245499 TCAGCACTGCTTCCGGTCGGTGG + Exonic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
948059500 2:235032684-235032706 TGGTCACTGCTTCTGGTAGGGGG + Intronic
948528769 2:238589760-238589782 TGCCCTGTGCTTCCAGTAAGGGG - Intergenic
1168917704 20:1504910-1504932 AGACCTCTGCTTCTGGTCAGGGG + Intergenic
1172044959 20:32073774-32073796 AGACCTCAGCTTCCAGAAGGGGG + Exonic
1175663951 20:60842597-60842619 AGACTTCTGCTTCCAGGAGGAGG - Intergenic
1181814385 22:25427139-25427161 TGGCTTCTGCTTCCAGTAGGGGG + Intergenic
1183563987 22:38599692-38599714 TGACCTTTGCTTCTGGGAAGAGG + Intronic
1184601518 22:45546588-45546610 TGACCTCTGCTTTAGGTAAAGGG + Intronic
1185178068 22:49341872-49341894 CGGCCTCTTCTTCCAGTAGGAGG - Intergenic
951106415 3:18748725-18748747 TGGCCTCTGCTTTTGGTGGGTGG + Intergenic
954646233 3:52133262-52133284 TGCCCTCTGCTTCCGAGATGGGG - Intronic
954939691 3:54360230-54360252 TGACCCCTGCTCCAGGTAGTTGG + Intronic
962265056 3:133938856-133938878 TGCCCTCTGCTTCTTGAAGGGGG - Intronic
967223088 3:187265647-187265669 TGACCTCTGTTTCCTATAGAAGG - Intronic
967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG + Intronic
972774045 4:42225158-42225180 TGGTCTCTGCTTCCTGGAGGAGG + Intergenic
974078651 4:57191054-57191076 TGTCCCCTTCTTCCGCTAGGGGG + Intergenic
987572497 5:19682583-19682605 TGCCCTCTGCTTCCTGGAGCTGG - Intronic
990381150 5:55222993-55223015 TGAAGTCTGCTTCCGTTTGGTGG + Exonic
991651772 5:68862937-68862959 TGACCTCTGCTTTAGGCAGAGGG - Intergenic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
999395347 5:151223615-151223637 TGCCCTCTGCTTTCGGTCTGGGG - Intronic
999470943 5:151854984-151855006 TGACCTCTGGTCCTGGTTGGGGG + Intronic
1000340633 5:160274686-160274708 TGACTTCTGGTTTCTGTAGGTGG - Intronic
1002037304 5:176481766-176481788 TGACCTCAGCTTCAAGTAGATGG + Intronic
1005402193 6:25446265-25446287 TGACATCTTCTTCCAGTAGGAGG + Intronic
1010127357 6:72448583-72448605 TGACCCCTCCTTCTGGTATGAGG + Intergenic
1012496836 6:99843056-99843078 TGAATTCAGCTTACGGTAGGAGG - Intergenic
1013108881 6:107049301-107049323 TCACCACTGCTTCCAGTAGGGGG - Intronic
1014310282 6:119791667-119791689 TGAGCTCTGCTTCCAGTATGAGG - Intergenic
1015144124 6:129966589-129966611 TGACCTATGCTTCCTGAAGTTGG - Intergenic
1015556862 6:134471697-134471719 AGACCTATGCTTCCTGCAGGAGG - Intergenic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1017747015 6:157456154-157456176 TGACCTCTGCCTCCCCGAGGAGG + Intronic
1020278734 7:6639171-6639193 TGACCACTGCTGGGGGTAGGGGG - Intronic
1022690138 7:32641748-32641770 TGACATCTTCTTCCAGTAGAAGG - Intergenic
1023600218 7:41875124-41875146 TGACCACTGGTTCCTGTGGGAGG + Intergenic
1024473526 7:49787810-49787832 TGAACTCTGCTACCAGTGGGAGG - Intronic
1026306914 7:69150381-69150403 TGAGCTCTCCTTTTGGTAGGAGG - Intergenic
1026462720 7:70629111-70629133 TGACCTCTTCTTGCATTAGGTGG - Intronic
1033678923 7:143573465-143573487 TCACCTGTGCTTCCGGAGGGAGG + Exonic
1033692915 7:143755989-143756011 TCACCTGTGCTTCCGGAGGGAGG - Exonic
1033706152 7:143886444-143886466 TAACCTATGCTTCCTGTAGTTGG - Intronic
1035591470 8:818072-818094 TGACCTCTGTTTCAGGTACCAGG + Intergenic
1036654769 8:10671085-10671107 TCACGTCTGCTTAAGGTAGGCGG - Intronic
1037457556 8:19079029-19079051 GGCCCTCTGCTTCCTATAGGTGG + Intronic
1039546176 8:38413139-38413161 TGACCTCTGCCCCAGATAGGTGG - Exonic
1039777577 8:40752092-40752114 TGATATGTGCTTCCAGTAGGAGG - Intronic
1041586480 8:59526227-59526249 TGACATCTTCTTCCAGTAGAAGG - Intergenic
1043975767 8:86583014-86583036 CAACCTCTGCTTCCTGTAGCTGG + Intronic
1046040740 8:108900791-108900813 TGACATCTTCTTCCAGTAGAAGG - Intergenic
1047731698 8:127734097-127734119 TGATCTCTGCTGCCAGTAGAGGG + Intergenic
1049602724 8:143515410-143515432 TGACATCAGCTTCCGGCAGACGG + Intronic
1049615668 8:143574897-143574919 TGTCCTCTGCTCCCTGCAGGTGG - Exonic
1050781116 9:9337326-9337348 TGTCCTCTCCTGCAGGTAGGGGG + Intronic
1052820453 9:33134262-33134284 TAAACTCTGCTTTAGGTAGGAGG - Intronic
1056803622 9:89711428-89711450 TGAGCTCTGCTTCCAGGAGCTGG + Intergenic
1061408698 9:130406512-130406534 TCACCTGGGTTTCCGGTAGGAGG - Intronic
1062062539 9:134504110-134504132 TAACCTCTGCCCCCGATAGGAGG - Intergenic
1062307266 9:135915146-135915168 GGACCTGTGCTTCCACTAGGAGG - Intergenic
1062526463 9:136979876-136979898 TCACCTCTGCTTCAGGGAAGGGG - Intronic
1199845324 X:151688617-151688639 TGACCTCTGCTTGGGGAAAGAGG + Intergenic
1200086545 X:153609994-153610016 TGACCGCAGCTGCCGCTAGGGGG + Intergenic