ID: 992944892

View in Genome Browser
Species Human (GRCh38)
Location 5:81800326-81800348
Sequence ATTTTGTAGCTGAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992944891_992944892 0 Left 992944891 5:81800303-81800325 CCATAACTTGTCTAGGAAGAAAT No data
Right 992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG No data
992944889_992944892 17 Left 992944889 5:81800286-81800308 CCTGCAACTTAGTAGTTCCATAA No data
Right 992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992944892 Original CRISPR ATTTTGTAGCTGAAAGCAGA TGG Intergenic
No off target data available for this crispr