ID: 992948375

View in Genome Browser
Species Human (GRCh38)
Location 5:81832237-81832259
Sequence TAGAACAAAAAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992948375_992948380 18 Left 992948375 5:81832237-81832259 CCTTGCTCCATCTTTTTGTTCTA No data
Right 992948380 5:81832278-81832300 TGCATGATGTCCATACACACTGG No data
992948375_992948381 19 Left 992948375 5:81832237-81832259 CCTTGCTCCATCTTTTTGTTCTA No data
Right 992948381 5:81832279-81832301 GCATGATGTCCATACACACTGGG No data
992948375_992948383 24 Left 992948375 5:81832237-81832259 CCTTGCTCCATCTTTTTGTTCTA No data
Right 992948383 5:81832284-81832306 ATGTCCATACACACTGGGGAAGG No data
992948375_992948382 20 Left 992948375 5:81832237-81832259 CCTTGCTCCATCTTTTTGTTCTA No data
Right 992948382 5:81832280-81832302 CATGATGTCCATACACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992948375 Original CRISPR TAGAACAAAAAGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr