ID: 992950922

View in Genome Browser
Species Human (GRCh38)
Location 5:81857335-81857357
Sequence TTACAAGCATGGGCTAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992950922_992950929 5 Left 992950922 5:81857335-81857357 CCCCATTTAGCCCATGCTTGTAA No data
Right 992950929 5:81857363-81857385 CTGCGCCATTCCCATAACAAGGG No data
992950922_992950935 27 Left 992950922 5:81857335-81857357 CCCCATTTAGCCCATGCTTGTAA No data
Right 992950935 5:81857385-81857407 GCATGAAGAAGCTTTTGGGTAGG No data
992950922_992950933 22 Left 992950922 5:81857335-81857357 CCCCATTTAGCCCATGCTTGTAA No data
Right 992950933 5:81857380-81857402 CAAGGGCATGAAGAAGCTTTTGG No data
992950922_992950928 4 Left 992950922 5:81857335-81857357 CCCCATTTAGCCCATGCTTGTAA No data
Right 992950928 5:81857362-81857384 ACTGCGCCATTCCCATAACAAGG No data
992950922_992950934 23 Left 992950922 5:81857335-81857357 CCCCATTTAGCCCATGCTTGTAA No data
Right 992950934 5:81857381-81857403 AAGGGCATGAAGAAGCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992950922 Original CRISPR TTACAAGCATGGGCTAAATG GGG (reversed) Intergenic
No off target data available for this crispr