ID: 992956156

View in Genome Browser
Species Human (GRCh38)
Location 5:81910664-81910686
Sequence ACTTCCCTGCAGAGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992956156_992956161 9 Left 992956156 5:81910664-81910686 CCTGCCACTCTCTGCAGGGAAGT No data
Right 992956161 5:81910696-81910718 CCCATGTAGAGTCAGAAGGTGGG No data
992956156_992956163 18 Left 992956156 5:81910664-81910686 CCTGCCACTCTCTGCAGGGAAGT No data
Right 992956163 5:81910705-81910727 AGTCAGAAGGTGGGTGAGACTGG No data
992956156_992956158 5 Left 992956156 5:81910664-81910686 CCTGCCACTCTCTGCAGGGAAGT No data
Right 992956158 5:81910692-81910714 CTAACCCATGTAGAGTCAGAAGG No data
992956156_992956164 24 Left 992956156 5:81910664-81910686 CCTGCCACTCTCTGCAGGGAAGT No data
Right 992956164 5:81910711-81910733 AAGGTGGGTGAGACTGGTGCTGG No data
992956156_992956159 8 Left 992956156 5:81910664-81910686 CCTGCCACTCTCTGCAGGGAAGT No data
Right 992956159 5:81910695-81910717 ACCCATGTAGAGTCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992956156 Original CRISPR ACTTCCCTGCAGAGAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr