ID: 992959906

View in Genome Browser
Species Human (GRCh38)
Location 5:81947825-81947847
Sequence CAAGTGTGCACTACCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992959906_992959909 -1 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959909 5:81947847-81947869 GTAGTCCCAGCTACTTGGGACGG 0: 441
1: 1913
2: 3656
3: 4870
4: 6949
992959906_992959915 11 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959915 5:81947859-81947881 ACTTGGGACGGCGAGGTGGGAGG No data
992959906_992959908 -5 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959908 5:81947843-81947865 ACTTGTAGTCCCAGCTACTTGGG 0: 587
1: 17471
2: 103078
3: 244273
4: 262232
992959906_992959916 30 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959916 5:81947878-81947900 GAGGATTGCTTGAGCTTGAGAGG No data
992959906_992959913 7 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959913 5:81947855-81947877 AGCTACTTGGGACGGCGAGGTGG No data
992959906_992959907 -6 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959907 5:81947842-81947864 CACTTGTAGTCCCAGCTACTTGG 0: 975
1: 30849
2: 105250
3: 132089
4: 152792
992959906_992959914 8 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959914 5:81947856-81947878 GCTACTTGGGACGGCGAGGTGGG No data
992959906_992959911 4 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959911 5:81947852-81947874 CCCAGCTACTTGGGACGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992959906 Original CRISPR CAAGTGTGCACTACCATTTC TGG (reversed) Intergenic
No off target data available for this crispr