ID: 992959913

View in Genome Browser
Species Human (GRCh38)
Location 5:81947855-81947877
Sequence AGCTACTTGGGACGGCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992959906_992959913 7 Left 992959906 5:81947825-81947847 CCAGAAATGGTAGTGCACACTTG No data
Right 992959913 5:81947855-81947877 AGCTACTTGGGACGGCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992959913 Original CRISPR AGCTACTTGGGACGGCGAGG TGG Intergenic
No off target data available for this crispr