ID: 992960388

View in Genome Browser
Species Human (GRCh38)
Location 5:81952701-81952723
Sequence CACTGCTCCTGCCTTATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992960388_992960390 24 Left 992960388 5:81952701-81952723 CCTCCAATAAGGCAGGAGCAGTG No data
Right 992960390 5:81952748-81952770 CTAGCACTTAGCACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992960388 Original CRISPR CACTGCTCCTGCCTTATTGG AGG (reversed) Intergenic
No off target data available for this crispr