ID: 992961081

View in Genome Browser
Species Human (GRCh38)
Location 5:81957125-81957147
Sequence GCCGCTGCTCGGAGACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992961081_992961084 3 Left 992961081 5:81957125-81957147 CCACCATGTCTCCGAGCAGCGGC No data
Right 992961084 5:81957151-81957173 TGCTGCCCTAATACTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992961081 Original CRISPR GCCGCTGCTCGGAGACATGG TGG (reversed) Intergenic
No off target data available for this crispr