ID: 992967446

View in Genome Browser
Species Human (GRCh38)
Location 5:82017566-82017588
Sequence AAGATATGTCCCTTCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 2, 2: 3, 3: 15, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992967446 Original CRISPR AAGATATGTCCCTTCTATGC TGG Intronic
902050938 1:13563212-13563234 AAGCCATGTCCCATCTGTGCTGG + Intergenic
903316447 1:22511654-22511676 ACGAGATGTCTCTTTTATGCAGG + Exonic
903895941 1:26604526-26604548 AAGATACATGCCTTCTCTGCAGG + Intergenic
905187183 1:36204916-36204938 AAGAAATGTCCCATTTATCCAGG + Intergenic
906716193 1:47971279-47971301 CAGACATGTCCCTGCTATCCTGG + Intronic
906736905 1:48138286-48138308 AAGATATGGCCCATCTAAACTGG + Intergenic
907163438 1:52388637-52388659 AAAATATGTCCCTACCATTCAGG - Exonic
907293625 1:53434578-53434600 AAGATGTGTCCCATCTGTGTGGG + Intergenic
907560933 1:55386701-55386723 AGGATATGGCCCTTCTATGAAGG - Intergenic
910002723 1:82358238-82358260 AAGCCATGTCCCATCTGTGCAGG - Intergenic
910144111 1:84058601-84058623 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
910454459 1:87382385-87382407 AAGACATGTCTCTTCTAGACAGG + Intergenic
910698268 1:90045199-90045221 ACAATATGTGCCTTATATGCAGG + Intergenic
911510597 1:98804619-98804641 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
911753807 1:101529541-101529563 AAAAGATGTCCCTTCAATGTGGG - Intergenic
911759760 1:101601413-101601435 AAGCCATGTCCCATCTGTGCGGG - Intergenic
912256331 1:108062281-108062303 AAGATATATCCGTTCAATACTGG - Intergenic
912813587 1:112811771-112811793 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
912815290 1:112823846-112823868 AAGCCATGTCCCATCTGTGCAGG - Intergenic
917276630 1:173338218-173338240 AAGAGCTGTCCCTTCCATGATGG - Intergenic
917639673 1:176970779-176970801 ATGAAATATCCCATCTATGCTGG - Intronic
918591310 1:186244731-186244753 AAGGCAAGTCCCTTCTATGTAGG + Intergenic
919476418 1:198037125-198037147 AAGCCATGTCCCATCTGTGCAGG + Intergenic
920427321 1:205888650-205888672 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
922079850 1:222285100-222285122 AAGATAGGTCCCCTTTATGTGGG - Intergenic
922598994 1:226835599-226835621 AAGCCATGTCCCATCTGTGCAGG + Intergenic
923075229 1:230603561-230603583 AAGCCATGTCCCATCTGTGCGGG + Intergenic
923227127 1:231948677-231948699 AAGATTTGCCCCTTCAATTCTGG - Intronic
923770716 1:236935633-236935655 AAGCCATGTCCCATCTGTGCGGG - Intergenic
923962808 1:239103702-239103724 AAGCCATGTCCCATCTGTGCGGG + Intergenic
924180675 1:241436303-241436325 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1063840241 10:10063851-10063873 AAGATATTTCACTACTTTGCAGG - Intergenic
1066103377 10:32137035-32137057 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1071187255 10:83059480-83059502 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1071550770 10:86564617-86564639 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1072011254 10:91304867-91304889 AAGCCATGTCCCATCTATGCGGG - Intergenic
1073394638 10:103207897-103207919 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1073638655 10:105226220-105226242 AAGGTACATTCCTTCTATGCTGG + Intronic
1073683543 10:105729710-105729732 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1074019049 10:109564697-109564719 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1075039329 10:119095359-119095381 AAGAAATGTACCTTCTAAGGCGG - Intergenic
1075114716 10:119616583-119616605 AAGTTGTGTCACTTCTAGGCAGG + Intergenic
1079727053 11:23890562-23890584 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1082197741 11:49324813-49324835 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1084245577 11:67854788-67854810 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1084835971 11:71802078-71802100 AAGGTTTGTACCTTCTGTGCTGG + Intergenic
1085570215 11:77552264-77552286 AAGCCATGTCCCATCTGTGCAGG + Intronic
1086005043 11:82027552-82027574 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1086134811 11:83434964-83434986 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1086136247 11:83446281-83446303 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1086550236 11:88045523-88045545 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1086658079 11:89383314-89383336 AAGCCATGTCCCATCTATGCGGG + Intronic
1087196938 11:95311854-95311876 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
1087434271 11:98093264-98093286 AAGATATATCCCTTCTGTCAAGG + Intergenic
1088554983 11:111052524-111052546 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1089953320 11:122549283-122549305 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1090526787 11:127546112-127546134 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1090546467 11:127772456-127772478 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1090871937 11:130756890-130756912 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1091788648 12:3258340-3258362 AAGACATGTCCTTTCCATCCAGG + Intronic
1092373243 12:7934546-7934568 AAGAAATGTCTCTTATATGTTGG - Intronic
1092407350 12:8230322-8230344 AAGGTTTGTACCTTCTGTGCTGG - Intergenic
1092739302 12:11613075-11613097 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1093951091 12:25165479-25165501 AAGCTGTGTCCCATCTGTGCAGG + Intronic
1095989293 12:48023236-48023258 AAAATATGCTCCTTCTCTGCTGG - Intronic
1095999003 12:48113511-48113533 AAGCCATGTCCCATCTGTGCGGG - Intronic
1097592443 12:61589583-61589605 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1098919925 12:76293791-76293813 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1099392101 12:82094293-82094315 AAGGTATATCCCTTCTATTCTGG + Intergenic
1099506554 12:83484344-83484366 AAGCTATGATCTTTCTATGCTGG - Intergenic
1102116720 12:110408642-110408664 AAGCTACGTCCCATCTGTGCGGG - Intergenic
1102160237 12:110762947-110762969 AAGGTAACTCCCTTCTCTGCTGG - Intergenic
1107880897 13:44831147-44831169 AAGATAAGTCCCTTGAATGGAGG + Intergenic
1110650465 13:77936700-77936722 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1113324358 13:109267680-109267702 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1114221698 14:20702915-20702937 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1115345785 14:32342063-32342085 AAGATTTGTCCCTTCCAGTCTGG - Intronic
1116703269 14:48265754-48265776 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1116791339 14:49343430-49343452 AAAATATAGCCCATCTATGCTGG + Intergenic
1117499731 14:56339762-56339784 TAGAAATCTCCCTTCTATGTGGG + Intergenic
1117658914 14:57984262-57984284 AAGATGTGTCTCTTCTCAGCGGG + Intergenic
1118937236 14:70299182-70299204 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1119022452 14:71126658-71126680 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1120539538 14:85736353-85736375 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1120618277 14:86733681-86733703 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1121193278 14:92048089-92048111 AAGCCATGTCCCATCTGTGCAGG - Exonic
1121289436 14:92762200-92762222 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1122507655 14:102241960-102241982 AAGCCATGTCCCATCTGTGCAGG + Intronic
1123882473 15:24688959-24688981 AAGCCATGTCCCATCTATGCGGG - Intergenic
1124472221 15:29998031-29998053 AAGATATTTCATTTCTTTGCTGG + Intergenic
1125519105 15:40338442-40338464 CAGATATGTCCCTCATTTGCGGG - Intronic
1125629243 15:41133840-41133862 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1126912384 15:53430212-53430234 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1127886324 15:63204465-63204487 AACATTTGTCCCTTCTAGACAGG - Intronic
1129259455 15:74356261-74356283 AAGCCATGTCCCATCTGTGCAGG + Intronic
1130263166 15:82375514-82375536 AAGATGTGTCCCTGCTATTTTGG + Intergenic
1130278128 15:82494148-82494170 AAGATGTGTCCCTGCTATTTTGG - Intergenic
1130470457 15:84221333-84221355 AAGATGTGTCCCTGCTATTTTGG - Intergenic
1130477945 15:84335900-84335922 AAGATGTGTCCCTGCTATTTTGG - Intergenic
1130493820 15:84452230-84452252 AAGATGTGTCCCTGCTATTTTGG + Intergenic
1130592744 15:85225959-85225981 AAGATGTGTCCCTGCTATTTTGG - Intergenic
1131684202 15:94753106-94753128 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1133651413 16:7817036-7817058 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
1133938197 16:10285487-10285509 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1143207988 17:5159501-5159523 AAGATATGTACCTTCCAAGGAGG + Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149319588 17:55470132-55470154 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1149872381 17:60194501-60194523 AAGATATGTACCTTCCAAGGAGG - Intronic
1155173840 18:23286373-23286395 AAGCTGTGTCCCATCTGTGCAGG + Intronic
1155336602 18:24771515-24771537 AACATGTGTCACTTCTTTGCTGG + Intergenic
1155892676 18:31287612-31287634 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1155914785 18:31546113-31546135 AAGATCTGTGTCTTCTAGGCAGG + Exonic
1155962019 18:32002940-32002962 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
1156924032 18:42555867-42555889 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1158099649 18:53816298-53816320 AAGATGTTTCCATTCTATTCAGG + Intergenic
1158419020 18:57276211-57276233 CAGATATTTTCCTTCTATGTTGG + Intergenic
1159123450 18:64196307-64196329 AAGAAATTCCCCTTTTATGCAGG + Intergenic
1159164486 18:64683974-64683996 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1159929235 18:74294765-74294787 AAGCAATGTCCCATCTGTGCAGG + Intergenic
1160954543 19:1684483-1684505 AAGATATTGCCCTGCTATGGTGG - Intergenic
1162722039 19:12668334-12668356 AAAATGTGACCCTTCTAGGCTGG + Exonic
1162987387 19:14279666-14279688 AGGACATGTGGCTTCTATGCAGG - Intergenic
1163900201 19:20094001-20094023 AAGCCATGTCCCATCTGTGCAGG - Intronic
1163944432 19:20522457-20522479 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1165510300 19:36262860-36262882 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1167099477 19:47395380-47395402 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1168248161 19:55124874-55124896 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
926407789 2:12572090-12572112 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
928857192 2:35815414-35815436 AAGCCATGTCCCATCTGTGCGGG + Intergenic
929383557 2:41380267-41380289 AAGCCATGTCCCATCTGTGCAGG + Intergenic
929793044 2:45037812-45037834 AAGCCATGTCCCATCTGTGCGGG - Intergenic
930099062 2:47589044-47589066 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
930159704 2:48142298-48142320 GAGATATGTCCCTTCTATGCTGG + Intergenic
931042635 2:58316030-58316052 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
931236959 2:60419945-60419967 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
931831632 2:66058533-66058555 GAGGGATGTACCTTCTATGCAGG - Intergenic
933079289 2:77967443-77967465 AAGCCATGTCCCATCTGTGCGGG + Intergenic
933616107 2:84483921-84483943 AAGATATCACCCTACTATCCTGG + Intergenic
933869549 2:86552375-86552397 AAGATCTGTCCCTTATTAGCTGG - Intronic
936153093 2:110032320-110032342 AGGAAATGTCCCATCTCTGCTGG - Intergenic
936191587 2:110339092-110339114 AGGAAATGTCCCATCTCTGCTGG + Intergenic
936870816 2:117132653-117132675 AAGCTGTGTCCCTTCTGTGGAGG + Intergenic
940107370 2:150114944-150114966 AAGTCGTGTCCCATCTATGCAGG + Intergenic
940508768 2:154586614-154586636 AAGCCATGTCCCATCTGTGCGGG - Intergenic
941019177 2:160389826-160389848 AAGATGTGTCCCCTGTATTCTGG + Intronic
943114451 2:183649111-183649133 AAGATATTTCTCTCTTATGCAGG - Intergenic
943421565 2:187673854-187673876 AAGCCATGTCCCATCTGTGCGGG - Intergenic
943806669 2:192132756-192132778 AAGCCATGTCCCATCTGTGCAGG + Intronic
945301460 2:208219613-208219635 AAGCCATGTCCCATCTGTGCAGG - Intergenic
946871736 2:224091227-224091249 AAGCCATGTCCCATCTGTGCGGG - Intergenic
946886517 2:224227624-224227646 AAGCCATGTCCCATCTGTGCAGG + Intergenic
947802934 2:232942884-232942906 AAGAAATTTCACTTCTCTGCTGG - Intronic
1173046732 20:39519914-39519936 AAGGTATGTGCCTTCTATTTGGG - Intergenic
1173763755 20:45587574-45587596 AAGCTGTGTCCCGTCTGTGCGGG - Intergenic
1173781745 20:45762127-45762149 AAGCTATGTCCTATCTGTGCAGG + Intronic
1174611772 20:51802906-51802928 AAGAGATCTCCCTTCTCGGCTGG - Intergenic
1174724270 20:52844896-52844918 TAGACATGTACCTCCTATGCAGG - Intergenic
1175555284 20:59849049-59849071 AATATATGTCCCATCTAACCAGG - Intergenic
1177031151 21:15983168-15983190 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1177102695 21:16916322-16916344 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1177840725 21:26231416-26231438 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1178336611 21:31749337-31749359 AAGATATGTCCCTGCTAGGTGGG + Intergenic
1179650345 21:42804403-42804425 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1180560964 22:16613963-16613985 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1185127618 22:49020232-49020254 AACAGATGTCCCTTCTAGGCAGG + Intergenic
950247035 3:11429979-11430001 AGGATATCTTCCTTCTATACAGG + Intronic
951332307 3:21381939-21381961 AAGCCATGTCCCATCTGTGCGGG - Intergenic
951888960 3:27551505-27551527 AAGCCATGTCCCATCTGTGCAGG - Intergenic
952469563 3:33632291-33632313 TACAGATGTCCCTTCTATTCAGG - Exonic
952663435 3:35877701-35877723 AAGCCATGTCCCATCTGTGCGGG - Intergenic
954033293 3:47835764-47835786 AAGATATGTCATTTGTAAGCAGG + Intronic
956233481 3:67042057-67042079 AAGCCATGTCCCATCTGTGCAGG - Intergenic
956361162 3:68449284-68449306 AAGATATGGGCTTTGTATGCAGG + Intronic
956548971 3:70438239-70438261 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
957394384 3:79620147-79620169 AAGCTGTGTCCCGTCTGTGCGGG + Intronic
957985708 3:87571690-87571712 AAGCCATGTCCCATCTGTGCGGG + Intergenic
958257753 3:91344550-91344572 AATATTTGTTCCTTCGATGCTGG + Intergenic
959485757 3:106926106-106926128 AAGCCATGTCCCATCTGTGCGGG - Intergenic
960146426 3:114208942-114208964 AAGTTATGGCCCCTCTCTGCAGG - Intergenic
961314605 3:126026065-126026087 AAGACCTGTCCCTGCTCTGCAGG - Intronic
961886014 3:130096926-130096948 AAGGTTTGTACCTTCTGTGCTGG - Intronic
962660653 3:137597807-137597829 AAGCCGTGTCCCATCTATGCGGG + Intergenic
963058643 3:141207297-141207319 AAGCCATGTCCCATCTGTGCGGG + Intergenic
963521642 3:146364386-146364408 AAGCCATGTCCCATCTGTGCAGG + Intergenic
964067915 3:152599776-152599798 AAGCCATGTCCCATCTGTGCAGG + Intergenic
964983652 3:162714735-162714757 AAGCCATGTCCCATCTGTGCAGG + Intergenic
965335118 3:167424925-167424947 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
965624863 3:170675899-170675921 AAGCCATGTCCCATCTGTGCGGG - Intronic
965626292 3:170686701-170686723 AAGCCATGTCCCATCTGTGCAGG - Intronic
965640020 3:170821335-170821357 AAGCCATGTCCCATCTGTGCGGG - Intronic
965861950 3:173159285-173159307 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
966085449 3:176063668-176063690 AAGCCATGTCCCATCTGTGCGGG + Intergenic
967005339 3:185377909-185377931 AAGCCATGTCCCATCTGTGCGGG - Intronic
967244149 3:187469648-187469670 AAGCTGTGTCCCATCTGTGCCGG - Intergenic
967474920 3:189905605-189905627 AAGCTCTGTCCCTTCTAGACAGG - Intergenic
967643812 3:191898746-191898768 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
967866026 3:194190603-194190625 AGAAGATGTCCCTTCTAGGCTGG - Intergenic
969003793 4:4003593-4003615 AAGCCATGTCCCATCTGTGCAGG - Intergenic
969654079 4:8486159-8486181 AAGCTGTGTCCCATCTGTGCGGG - Intronic
969810135 4:9641232-9641254 AAGCCATGTCCCATCTTTGCAGG + Intergenic
972456457 4:39260635-39260657 AAGATATGGCCCTACTAGGCTGG - Intronic
974420853 4:61671355-61671377 AAGATGTGTATCTTCTATGACGG + Intronic
974801510 4:66824635-66824657 AAGGTATGTCCCTTCTATGAAGG + Intergenic
976990744 4:91362055-91362077 CAAATATGTCCCTTCCGTGCAGG - Intronic
977217138 4:94296596-94296618 AAGACATGTCCCATCTGTGCGGG - Intergenic
977225326 4:94386849-94386871 AAGCCATGTCCCATCTGTGCGGG - Intergenic
977277409 4:94994727-94994749 AAGTTATTTTTCTTCTATGCTGG + Intronic
977446420 4:97137982-97138004 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
977782420 4:100995160-100995182 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
978767459 4:112418758-112418780 AAGAAAGTTCCCTCCTATGCAGG - Intronic
979781911 4:124662460-124662482 ACAATATGTCCTTTCTGTGCTGG - Intergenic
979895142 4:126148517-126148539 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
980970478 4:139562632-139562654 AAGATATTTCTATTCTGTGCAGG + Intronic
982180464 4:152744713-152744735 AAGCCATGTCCCATCTGTGCAGG - Intronic
982414176 4:155111842-155111864 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
983833398 4:172359706-172359728 AAGCTATGTGCCTTATATGTGGG - Intronic
983883740 4:172959750-172959772 AAGCCATGTCCCATCTGTGCAGG - Intronic
984165340 4:176298229-176298251 AAGCCATGTCCCATCTGTGCAGG - Intergenic
985435738 4:189928183-189928205 AAGCCATGTCCCATCTGTGCAGG + Intergenic
985582372 5:705119-705141 AAGCTGTGTCCCGTCTGTGCGGG + Intergenic
986193552 5:5517885-5517907 AAGCCATGTCCCATCTGTGCGGG + Intergenic
986502656 5:8416426-8416448 AAGCCATGTCCCATCTGTGCAGG + Intergenic
987143466 5:14968171-14968193 CAGACATGTCCCCTCTATGAAGG - Intergenic
987487520 5:18540639-18540661 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
988199115 5:28047969-28047991 AAGCCATGTCCCATCTGTGCGGG + Intergenic
990565108 5:57020361-57020383 AAGCCATGTCCCATCTCTGCAGG - Intergenic
991421174 5:66443864-66443886 ATGATATGTGGCTTCTCTGCAGG + Intergenic
992451985 5:76883764-76883786 AAGCCATGTCCCATCTGTGCGGG - Intronic
992967446 5:82017566-82017588 AAGATATGTCCCTTCTATGCTGG + Intronic
993836723 5:92826305-92826327 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
995334495 5:110983803-110983825 AATATCCGTGCCTTCTATGCAGG - Intergenic
995362457 5:111313015-111313037 AAGGGATGCCCCTTCTATTCTGG + Intronic
995899350 5:117049745-117049767 AAGCCATGTCCCATCTGTGCGGG - Intergenic
995970619 5:117966053-117966075 AAATTATGTCCATTCTATCCTGG + Intergenic
996358606 5:122622248-122622270 AAGCCATGTCCCATCTGTGCAGG - Intergenic
996912425 5:128670601-128670623 AAGCCATGTCCCATCTGTGCGGG - Intronic
997770611 5:136549701-136549723 AAGCCATGTCCCATCTGTGCAGG - Intergenic
998962754 5:147506302-147506324 AGGATGTTCCCCTTCTATGCTGG - Intronic
1000606950 5:163336354-163336376 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1003029091 6:2585729-2585751 AAGGTATGTCCCTTGTATGCCGG + Intergenic
1003430147 6:6031163-6031185 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
1003657917 6:8030958-8030980 AGGGTATGTCCCTTCTATACCGG - Intronic
1004106285 6:12669707-12669729 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1007300967 6:40867587-40867609 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1008803620 6:55401073-55401095 AAGGGATATGCCTTCTATGCAGG - Intronic
1009269837 6:61602432-61602454 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1009750287 6:67872346-67872368 AAGCCATGTCCCATCTATGTGGG - Intergenic
1010841295 6:80651178-80651200 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1011367881 6:86601751-86601773 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1014115322 6:117663066-117663088 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1014891561 6:126851083-126851105 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1015278174 6:131405142-131405164 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
1016650274 6:146453796-146453818 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1018135736 6:160777254-160777276 AAGCTGTGTCCCATCTGTGCGGG + Intergenic
1020541124 7:9461936-9461958 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
1020995761 7:15261973-15261995 AAAATATGTCCCTTCTATGCTGG - Intronic
1021660642 7:22915448-22915470 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1021810679 7:24398606-24398628 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1021977878 7:26027568-26027590 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1022447420 7:30481561-30481583 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1022572774 7:31470408-31470430 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1023698868 7:42873988-42874010 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1027354441 7:77342027-77342049 AAGCCGTGTCCCATCTATGCGGG + Intronic
1028546828 7:92011032-92011054 AAGAAATTTCCCTTCTATTCTGG - Intronic
1030022665 7:105291244-105291266 AAGATATGTCACTTTTAAGTAGG + Intronic
1030751482 7:113236959-113236981 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
1031727912 7:125262283-125262305 AAGCCATGTCCCTTCTGTGTGGG - Intergenic
1032561076 7:132893424-132893446 AAGGAAAGTCCCTTCTATGTAGG - Intronic
1033088576 7:138364879-138364901 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1033465017 7:141582166-141582188 AAGCTATGTCCCATCTGTACAGG - Intronic
1033625605 7:143107151-143107173 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1034084814 7:148313431-148313453 AAGCCATGTCCCATCTGTGCGGG - Intronic
1036639510 8:10573598-10573620 AAGCCGTGTCCCATCTATGCAGG + Intergenic
1036847720 8:12181242-12181264 AAGGTTTGTACCTTCTGTGCTGG - Intergenic
1036869088 8:12423557-12423579 AAGGTTTGTACCTTCTGTGCTGG - Intergenic
1039498985 8:38002058-38002080 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1041342412 8:56859507-56859529 AAGATGTATCCCTTCCAGGCAGG + Intergenic
1041651825 8:60309881-60309903 AAGCCATGTCCCATCTATGCGGG - Intergenic
1042870274 8:73391846-73391868 AAGATAAGCCCCTTCTTTGAAGG - Intergenic
1044258598 8:90093585-90093607 AAGCCATGTCCCATCTGTGCGGG - Intronic
1044276635 8:90308023-90308045 AAAATATTTCACTTTTATGCAGG - Intergenic
1048006463 8:130423226-130423248 AACATATTTCCCAGCTATGCAGG - Intronic
1048585403 8:135770522-135770544 AAGCTGTGTCCCATCTGTGCGGG - Intergenic
1049868800 8:144957640-144957662 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1050147705 9:2587189-2587211 AAGATATGTCCCTTGAATGCTGG - Intergenic
1050896091 9:10887096-10887118 AAGCCATGTCCCATCTCTGCAGG + Intergenic
1051842636 9:21415469-21415491 CTGATATGTCCCTTCTGTTCAGG - Intronic
1052720623 9:32167892-32167914 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1053620849 9:39814293-39814315 AAGAAATGTGCTTTCTATGGTGG + Intergenic
1054263313 9:62893149-62893171 AAGAAATGTGCTTTCTATGGTGG - Intergenic
1055881765 9:81011337-81011359 AAGCTGTGTCCCATCTGTGCAGG + Intergenic
1056432855 9:86545877-86545899 AATATATGTGCATTCTATGAGGG + Intergenic
1057982100 9:99672489-99672511 AAGCCATGTCCCATCTATGTGGG + Intergenic
1058779388 9:108318038-108318060 ATGATATGTCCTTACTATGTGGG + Intergenic
1059546141 9:115178000-115178022 AAGCCATGTCCCATCTGTGCAGG - Intronic
1060040643 9:120297399-120297421 AAGATAAGCCCCTTCCCTGCAGG + Intergenic
1060226214 9:121792654-121792676 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1060328205 9:122638869-122638891 AAGATTTCTCCCTTCTATTCCGG - Intergenic
1061583089 9:131549416-131549438 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1187749085 X:22441954-22441976 AAGGTATGTCCCTTGTATGTGGG - Intergenic
1188200952 X:27292523-27292545 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1188301041 X:28505805-28505827 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1189031794 X:37459148-37459170 AAGCCATGTCCCATCTGTGCGGG - Intronic
1191014176 X:55791686-55791708 AAGCCATGTCCCATCTGTGCAGG - Intergenic
1192031677 X:67520417-67520439 GAGGTATGCCCCTTGTATGCCGG - Intergenic
1192454611 X:71266513-71266535 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1192731504 X:73806291-73806313 AAGCCATGTCCCATCTATGCAGG - Intergenic
1193537113 X:82729191-82729213 AAGCCATGTCCCTTCTGTGTGGG + Intergenic
1193867125 X:86747325-86747347 AAGATATTTTCCTTTTATTCAGG + Intronic
1194308524 X:92276438-92276460 AAGCTGTGTCCCATCTGTGCAGG - Intronic
1195016932 X:100789799-100789821 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1196163169 X:112508326-112508348 AATATATGTGCATCCTATGCTGG - Intergenic
1196220964 X:113112097-113112119 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1196227200 X:113180179-113180201 AAGCTGTGTCCCATCTGTGCAGG - Intergenic
1196469921 X:116013004-116013026 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1196496885 X:116333154-116333176 AAGCAATGTCCCATCTGTGCAGG + Intergenic
1196572516 X:117281490-117281512 AAGCCATGTCCCATCTGTGCGGG + Intergenic
1196773837 X:119321144-119321166 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1197470981 X:126865434-126865456 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1198965941 X:142228881-142228903 AAGCCATGTCCCATCTGTGCAGG + Intergenic
1200532821 Y:4358776-4358798 AAGCCATGTCCCATCTGTGCGGG - Intergenic
1201581406 Y:15514706-15514728 AAGCCATGTCCCATCTGTGCAGG + Intergenic