ID: 992969951

View in Genome Browser
Species Human (GRCh38)
Location 5:82046169-82046191
Sequence TTGGAGAAGCAGGAAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 900
Summary {0: 1, 1: 0, 2: 5, 3: 91, 4: 803}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992969951_992969955 22 Left 992969951 5:82046169-82046191 CCTACCTCTTCCTGCTTCTCCAA 0: 1
1: 0
2: 5
3: 91
4: 803
Right 992969955 5:82046214-82046236 TCCCCAAATTCATGTCCACCTGG 0: 4
1: 6
2: 40
3: 133
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992969951 Original CRISPR TTGGAGAAGCAGGAAGAGGT AGG (reversed) Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900908328 1:5576388-5576410 TCGGAGCTCCAGGAAGAGGTGGG - Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901335777 1:8447826-8447848 TCGGAGAAGCAGGCAGAGCCTGG - Intronic
901426448 1:9184587-9184609 TTGGGGGTGCAGGGAGAGGTTGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901640153 1:10688993-10689015 GAGGAAAAGGAGGAAGAGGTGGG + Intronic
902078718 1:13806557-13806579 GTGGGGATGGAGGAAGAGGTTGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902513459 1:16978241-16978263 CAGGAATAGCAGGAAGAGGTAGG + Exonic
902645749 1:17796752-17796774 CTGAAGAAGCTTGAAGAGGTCGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903218858 1:21857742-21857764 TTGGAGAGGCTGGAGGAGATGGG - Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903861083 1:26364874-26364896 TTGGGGCAGCATGAGGAGGTGGG + Exonic
904250891 1:29223491-29223513 TTTGAGCAGGAAGAAGAGGTAGG + Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904424799 1:30416406-30416428 CTGGAGTAGGAGGCAGAGGTGGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906727740 1:48056016-48056038 TTGGAGAAGAGGGAGGAGCTGGG - Intergenic
906987373 1:50698178-50698200 TTGGGGAGGAATGAAGAGGTTGG + Intronic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907765935 1:57410500-57410522 TTGGAAAGGCAGGCAGAGGCAGG + Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910909281 1:92216626-92216648 TTGGGTAAGCAAGAAGAGATGGG + Intergenic
911091562 1:94021484-94021506 TTTGAGAAGCAGGAAGGGTTTGG + Intronic
911302678 1:96193742-96193764 TGCCAGAAGCAGGAAGAAGTGGG - Intergenic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912250544 1:108007976-108007998 TTGGAGGAGGAGGAAGAGGTAGG + Intergenic
912275109 1:108248263-108248285 TTGAAGAAGCAGTAAGTTGTAGG - Intergenic
912293113 1:108446086-108446108 TTGAAGAAGCAGTAAGTTGTAGG + Intronic
912410808 1:109479614-109479636 TTGGAGGAGGAGGAAGAGAAAGG - Exonic
912414175 1:109497048-109497070 TTGGAGAAGCAGGAGGGCATTGG + Intronic
912582926 1:110736388-110736410 TGTGAGGAGCAGGAAGTGGTTGG - Intergenic
912694548 1:111831413-111831435 TGGGAGCAGGAGGAAGAGGTTGG - Intronic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915227765 1:154423381-154423403 TTGGAGAGGAGGGCAGAGGTAGG + Intronic
915345026 1:155193024-155193046 GGGGAGGAGGAGGAAGAGGTAGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915863865 1:159477223-159477245 TTGTGACAGCAGGAAGAGGTAGG + Intergenic
916712470 1:167424211-167424233 TTGGAGAACATGGAACAGGTTGG + Exonic
917159690 1:172043598-172043620 CTAGTTAAGCAGGAAGAGGTAGG + Intronic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
918083464 1:181224972-181224994 TTATAGAAGCAGGGAGAAGTGGG + Intergenic
918678068 1:187315082-187315104 TGGGAGAAGGAGGAACAGGGAGG - Intergenic
919928055 1:202202856-202202878 TTGGAGGTGCTGGAGGAGGTGGG + Intronic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920205102 1:204285820-204285842 TTGGAGAAGGAAGAAGAGTTGGG + Intronic
920228188 1:204453047-204453069 CTGGAGATGCTGGAAGAGGTGGG - Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
920447900 1:206033849-206033871 TTGAGGCAGCAGGAACAGGTTGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921115792 1:212089851-212089873 TTGGGGAAGAAGGAAGAGCTGGG - Intronic
921482201 1:215676418-215676440 TTGTTGGAGCAGGAAAAGGTTGG - Intronic
921482307 1:215677251-215677273 TTGGGGAAGGAGGAAGGGATGGG - Intronic
921758720 1:218887328-218887350 GGGGAGAAACAGGAAAAGGTGGG + Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
922936355 1:229426014-229426036 GTGGAGACGGAGGCAGAGGTTGG + Intergenic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923219818 1:231882934-231882956 TAGGAGAAGAAGGAATGGGTGGG + Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923850164 1:237785632-237785654 TTAGATAAGAATGAAGAGGTAGG + Intronic
1062765321 10:58324-58346 TTGGGTAAACAGGCAGAGGTTGG - Intergenic
1063036123 10:2288536-2288558 GTGGAGAGGGAGGGAGAGGTCGG + Intergenic
1063707883 10:8448767-8448789 TGGGAGGAGCAGGTTGAGGTGGG - Intergenic
1064457086 10:15497829-15497851 TTGGAGAAGGAGGGAGTGGATGG + Intergenic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067161405 10:43827905-43827927 CTGGACAAGCAGCAAGAGCTGGG - Intergenic
1067819079 10:49510848-49510870 TAGGAAATGCAGCAAGAGGTAGG - Intronic
1068044674 10:51871367-51871389 TGGGGGAAGCAAGAAGACGTGGG - Intronic
1068264468 10:54628245-54628267 GAGAAGAAGCAGGAAGATGTAGG + Intronic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1068487187 10:57674913-57674935 TGGGAGAATGAGGAGGAGGTTGG + Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069890530 10:71649487-71649509 TTGGGGAAGCTGGAATAGGAAGG + Intronic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070406758 10:76104388-76104410 TTGGACAATGAGGGAGAGGTAGG + Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070820016 10:79349017-79349039 TTGGAGAGGCAGGTGAAGGTGGG - Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071968032 10:90872480-90872502 TCGGAGAAGGAGGAGGACGTGGG + Intronic
1073169391 10:101490693-101490715 TTATACAAGCAGCAAGAGGTAGG - Intronic
1073403298 10:103276430-103276452 TTGGAGAAGCAGGAGGCGCTGGG - Intergenic
1073580645 10:104662780-104662802 TAGGAGAGTCAGGAAGAGATGGG + Intronic
1073696969 10:105880412-105880434 TTGGAGAAGCACGAAAAAGGGGG - Intergenic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1073854188 10:107656041-107656063 TTGGAAGAACAAGAAGAGGTAGG - Intergenic
1073946544 10:108757285-108757307 TTGTAAAACCAGCAAGAGGTGGG - Intergenic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074202008 10:111245770-111245792 TTGGAGAGGCAGGAAGATTTTGG + Intergenic
1075213147 10:120508766-120508788 TTTGAGTAGCAGGAGGAGGTTGG - Intronic
1075445214 10:122508300-122508322 TGGGAGAAGCAGGAAGGTGTGGG + Intronic
1075705516 10:124497909-124497931 TTGAAGAAGCAGGATGCTGTGGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077578364 11:3401523-3401545 TTGGGGAAGCTGGGAGAGGAGGG + Intergenic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1078227956 11:9410116-9410138 TTTGAGAAGTAGGAAAAGTTGGG + Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1079308299 11:19343992-19344014 TTTGGGATGCAGGAAGAGATTGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081561862 11:44225132-44225154 TGGGAGGAGGAGGAAGAGATGGG - Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1083068043 11:59945938-59945960 CTGGAGCAGGAGGAAGTGGTCGG + Intergenic
1083201340 11:61122884-61122906 CTGGGGAAGGAGGAAGAGTTAGG - Intronic
1083506830 11:63165797-63165819 TTTGAGAAGTAGTAAGAAGTTGG - Intronic
1083739510 11:64701336-64701358 TTATAGAAACAGGAAGAAGTTGG - Intronic
1083749414 11:64753182-64753204 TTGAAGCTGCAGGATGAGGTTGG + Exonic
1083832838 11:65243950-65243972 GTGGAGCAGCACGCAGAGGTAGG - Intergenic
1084137597 11:67198080-67198102 TAGGCTAAGGAGGAAGAGGTGGG + Intronic
1084763661 11:71293563-71293585 TTGGAGCAGGAGGAAGTGGGGGG + Intergenic
1085191984 11:74634626-74634648 GTGGAGACGGAGGAGGAGGTGGG - Exonic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085557747 11:77440851-77440873 TGGGAGGAGCAGGTAGAGGTGGG - Intronic
1085557752 11:77440870-77440892 TGGGAGGAGCAGGTAGAGGTGGG - Intronic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1088532633 11:110827421-110827443 TCCCAGAAGCTGGAAGAGGTAGG + Intergenic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1089713008 11:120330452-120330474 TTGGAGAAGCAGGCGGAGTGAGG + Exonic
1090920169 11:131199842-131199864 TTGGAGAAACAGGCATAAGTGGG + Intergenic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091307226 11:134544010-134544032 GTGGAGAAGGAAGCAGAGGTGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091545624 12:1499703-1499725 TGGGAGCAGCAGGAGGAGTTGGG - Intergenic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1092010195 12:5103647-5103669 TTGGAGAAGGAACAAGAGATTGG - Intergenic
1092087017 12:5770917-5770939 TTGGAGCAGATGGAGGAGGTAGG - Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093933042 12:24973386-24973408 TTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094591267 12:31823214-31823236 TTGGAGACTCAGGAAAAGGTGGG - Intergenic
1095101484 12:38189567-38189589 TTGGGTAAACAGGCAGAGGTTGG + Intergenic
1095328219 12:40924046-40924068 TTTGAGAAGGAGCAAGAGATTGG + Intronic
1095441148 12:42239357-42239379 TGGGAGAGGGAGGCAGAGGTAGG - Intronic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1096066950 12:48748658-48748680 TTGAAGAAACAGGAGAAGGTAGG - Intergenic
1096151351 12:49315123-49315145 TTGGACAAACAGGAAGAAGTGGG - Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1097184114 12:57187476-57187498 TGGGGGTAGCAGGGAGAGGTGGG + Intronic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1098164833 12:67684417-67684439 TTGGGGGAGTGGGAAGAGGTAGG - Intergenic
1099809891 12:87567660-87567682 TTGGAGATGCAGTCATAGGTGGG + Intergenic
1100114594 12:91288878-91288900 TTGGGGAAGGATGGAGAGGTTGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100522405 12:95387998-95388020 TTAGAGAAGCAGAAAGCTGTAGG + Intergenic
1101332903 12:103771587-103771609 TTGGAGATGTGGGGAGAGGTGGG - Intronic
1101944997 12:109129928-109129950 TTGGTGCAGCAGGAAGGGGAAGG + Intronic
1101959013 12:109234082-109234104 TTGGAGAAGGAGGAGGGGCTGGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1103117349 12:118347637-118347659 TAGGATAAGCCAGAAGAGGTGGG - Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103821012 12:123698785-123698807 TTTGGGAAGCAGGAAGAAATGGG + Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1103875844 12:124126487-124126509 TAGGAGAAGAAGGAAGATGTGGG + Intronic
1104083999 12:125458037-125458059 TTGAAGAAGGAGGCAGAGGGTGG + Intronic
1105580342 13:21689890-21689912 TGGAAGAAGCAGGAAGAGCTTGG - Intronic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106404449 13:29461799-29461821 TGGGATACTCAGGAAGAGGTTGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106646674 13:31641921-31641943 TGGGAGAAATAGGAAGAAGTTGG + Intergenic
1106795694 13:33202701-33202723 TTGGAGGAGGAGGAGGATGTTGG + Intronic
1106968557 13:35105321-35105343 TTGGAAAGGCAGCAAAAGGTTGG + Intronic
1107022988 13:35770838-35770860 TTGGAGAATGGGGAAGAAGTTGG + Intronic
1108372938 13:49788942-49788964 TTGAAGGAGGAGGAAGAGGGAGG + Intronic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1108650961 13:52479162-52479184 GGGGAGAAGCATGAACAGGTTGG - Intergenic
1108974703 13:56424315-56424337 TTGGAAATGCAGGAGGAGCTGGG + Intergenic
1108999870 13:56785835-56785857 TTGAAGAAGCAGGAAGGAATAGG + Intergenic
1109641581 13:65198770-65198792 TAAAATAAGCAGGAAGAGGTAGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110735236 13:78928565-78928587 TTGGAAAAGAAGGAAGAACTTGG - Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1111388008 13:87554584-87554606 TTGTAAAACCAGTAAGAGGTTGG - Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112335095 13:98508105-98508127 TTGAAGTAGCAAGAAGCGGTGGG - Intronic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112607082 13:100917077-100917099 TAGGAGCAGCACGAAGAGGGTGG + Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1112992772 13:105534361-105534383 TTGAAGAAACAGTAAGGGGTAGG + Intergenic
1113090426 13:106612302-106612324 CTTGAGAAGCCAGAAGAGGTGGG - Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113670480 13:112172281-112172303 GTGAAGATGCAGGCAGAGGTCGG - Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114754080 14:25239021-25239043 TTAGAGAAGCTGCAAGTGGTAGG + Intergenic
1115283490 14:31691181-31691203 GAGGAAAAGGAGGAAGAGGTGGG - Intronic
1115315787 14:32023604-32023626 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117870125 14:60191892-60191914 TTAGAGAAGAAGGAAAAGGGAGG + Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118971845 14:70643431-70643453 TGGGAGAAGGTGGGAGAGGTTGG + Intronic
1119355519 14:74003117-74003139 TTGAGAAAGCAGGTAGAGGTGGG - Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119962393 14:78874507-78874529 TAGGAGTTGCAGGAAGTGGTGGG - Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120030096 14:79631447-79631469 GTGGAGAGACAGGCAGAGGTGGG + Intronic
1120241453 14:81954247-81954269 GTAGAGAAGCAAGAAGAGTTTGG - Intergenic
1120823481 14:88934235-88934257 TTTGAGAAGCAGCAAGCGGTGGG - Intergenic
1121224728 14:92312897-92312919 TTGGAGAAGCAACAAGAAATTGG + Intergenic
1122262412 14:100530933-100530955 TGGGGGACGCAGGAGGAGGTGGG + Intergenic
1122305561 14:100764089-100764111 GAGGAGGAGGAGGAAGAGGTGGG + Intergenic
1122326453 14:100883547-100883569 CATGAGCAGCAGGAAGAGGTGGG + Exonic
1123484428 15:20675198-20675220 TTGGAAAGGCAGCAAAAGGTTGG - Intergenic
1123537155 15:21244165-21244187 TTGGAAAGGCAGCAAAAGGTTGG - Intergenic
1124046384 15:26154613-26154635 TTGGAGTACCAGAAAGAGATGGG - Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124404752 15:29383067-29383089 TTGGGAAACCAGGAAGAGGTTGG - Intronic
1125338536 15:38652060-38652082 TTGGAGAGGCAGGAAGAGAGGGG - Intergenic
1125463656 15:39929836-39929858 TTGGAGAAGAAGGAAATGTTGGG + Intergenic
1125492346 15:40157719-40157741 TTAGAGAAGAAGGCAGAGATGGG + Intergenic
1125727272 15:41874480-41874502 TAGGAGGAGGAGGAAGAGATTGG + Intronic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1127489832 15:59452107-59452129 CTGAAGAATCAGGAAGAGATGGG - Intronic
1127547430 15:60004200-60004222 TGGGAGGAGGAGGAAGAGGAGGG - Exonic
1127843124 15:62847295-62847317 TTGGAAAAGCAGGAAGGGAGAGG + Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1127969584 15:63947846-63947868 TGGGAGAAGGAAGAAGAGCTGGG - Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128266268 15:66269237-66269259 TTGGAGATGGAGGTGGAGGTGGG - Intergenic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128351877 15:66896327-66896349 CTGGAGAAGCAGGCAGATCTAGG + Intergenic
1128522845 15:68386896-68386918 TGAGAGAAGCAGGGAGAGGTGGG + Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129678249 15:77643809-77643831 ATGCTGGAGCAGGAAGAGGTGGG - Intronic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1130016755 15:80193331-80193353 GTGGAGGTGCAGGCAGAGGTTGG + Intergenic
1130245065 15:82239434-82239456 TTGTAGAAATAGGAAGAGGTAGG - Intronic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130571071 15:85044335-85044357 TGGGAAAATCAGGAACAGGTAGG + Intronic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130901766 15:88212638-88212660 TTGGAGAGGTAGGAGGAGCTGGG - Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1132851190 16:2025744-2025766 TTGGAGACAGAGGAAGAGCTGGG + Intronic
1133030535 16:3008735-3008757 TAGGAGAGGCTGGAAGAGGGTGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134029055 16:10977382-10977404 CTGGAGAACCAGGACAAGGTGGG + Exonic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1135091974 16:19524329-19524351 TCGGAGGAGCTGGAGGAGGTGGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135384592 16:22026095-22026117 TTGGTGAAGCAGGAGGAATTAGG - Intronic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135620318 16:23950082-23950104 TGGCAGAAGCAGGAGGAAGTGGG - Intronic
1135646738 16:24169481-24169503 TTGGAGAAGAAAGAAGAAGGGGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135926409 16:26697715-26697737 TTGAAGAAGCAGGAAGCCATGGG + Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135978164 16:27124749-27124771 TTACAGAAGCAGAAAGGGGTGGG + Intergenic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136421615 16:30137633-30137655 TTGGGGAGGCGGGAGGAGGTTGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137542528 16:49374773-49374795 TTGGAGAAAGAGGAAAGGGTGGG - Intronic
1137598223 16:49738774-49738796 TGGGAGAAGAAGTGAGAGGTGGG - Intronic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1137854061 16:51775818-51775840 TTGGAAGAGAAGGAGGAGGTGGG - Intergenic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1138062500 16:53906723-53906745 TGGTAGAAGCAGGAAGATGCAGG + Intronic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1139067514 16:63336617-63336639 TTGGAGTAGGAGGAAGAGAGAGG + Intergenic
1140196447 16:72859434-72859456 TGGGAGAAGAAGGCTGAGGTGGG - Intronic
1140866192 16:79064646-79064668 TTGCAGGAACACGAAGAGGTTGG - Intronic
1140972259 16:80024762-80024784 TTGGTGATGAAGGCAGAGGTAGG + Intergenic
1140976148 16:80062077-80062099 TTGGAGAGGGAGGAACAGGGAGG + Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141725383 16:85784742-85784764 ATGCAGGAGCAGGCAGAGGTGGG - Intronic
1141769094 16:86078080-86078102 TTGGAAGCTCAGGAAGAGGTAGG - Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142439338 16:90084982-90085004 TTGGGTAAACAGGCAGAGGTTGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143579731 17:7818491-7818513 AGGGTGAAGCAGGAAGAGTTTGG + Intronic
1143648453 17:8247839-8247861 TCGCAGAACCAGTAAGAGGTAGG + Intronic
1143953747 17:10653411-10653433 GTGGTGAAGGGGGAAGAGGTGGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1144580453 17:16456128-16456150 TAGGAGGAGGAGGAAGAGGAGGG + Intronic
1145034287 17:19529569-19529591 TTGGAGATGGAGGAAGAGGGAGG + Intronic
1145218240 17:21068317-21068339 TTGGAGGAGCTGGAAGGAGTGGG - Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145915775 17:28573255-28573277 TTGTGGGAGCTGGAAGAGGTAGG + Exonic
1146466304 17:33089370-33089392 TTCTAGAAGCAGGAAAAGGCAGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147653289 17:42073938-42073960 TTGGTGAACCAGGAAGTGCTAGG - Intergenic
1147904598 17:43814481-43814503 TTCCAGTAGCAGGAGGAGGTTGG - Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148698582 17:49575506-49575528 TTGGAGAGGAAGGGAGAGGGTGG - Intergenic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149446689 17:56718650-56718672 CTGGAGAGGCAGGTAGAAGTCGG + Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1150831704 17:68527092-68527114 TTGTCAAAGAAGGAAGAGGTAGG + Intronic
1150888886 17:69121598-69121620 TGGGAGAAGAAGGGAGAAGTTGG + Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151910399 17:77079117-77079139 TTCGAGGAGGAGGGAGAGGTGGG - Intergenic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152112838 17:78366530-78366552 TTGGAGAGGCAGGAGCTGGTGGG + Intergenic
1152274692 17:79349446-79349468 TGGGAGAAGGAGGAGAAGGTGGG - Intronic
1152723323 17:81933377-81933399 CTAGAGAGGCAGGGAGAGGTTGG + Intronic
1152958234 18:58674-58696 TTGGGTAAACAGGCAGAGGTTGG - Intronic
1153597362 18:6741404-6741426 CTCCAGAAGCTGGAAGAGGTGGG - Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155530307 18:26759928-26759950 TTGGAGAATCTGGTAGAGGAAGG + Intergenic
1155757803 18:29523580-29523602 TTGGAGAAGAATGTAGTGGTGGG - Intergenic
1155794096 18:30011743-30011765 TTGGTGAAACATGAGGAGGTTGG - Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1156664731 18:39391295-39391317 TTGGAGAACCTGAAAGAGATGGG + Intergenic
1156685059 18:39634422-39634444 TTAGAGAAGAATGAAGAGGTAGG - Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157803996 18:50644531-50644553 TTGGAGAGAAAGGAAGAGGGAGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158494654 18:57943471-57943493 GAGGAGAAGGAGGGAGAGGTTGG - Intergenic
1158646193 18:59249830-59249852 TGGGAGAGGTAGGAAGGGGTGGG + Intergenic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159033800 18:63258148-63258170 TTCCAGGAGCTGGAAGAGGTGGG + Intronic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160309816 18:77778789-77778811 ATGGAGTTGCAGGAAGGGGTGGG + Intergenic
1160408960 18:78661689-78661711 TGGGTGGAGCAGGAAGAGGAGGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161238762 19:3210471-3210493 GAGAAGAAGCAGGGAGAGGTGGG + Intergenic
1161607355 19:5222446-5222468 GTGGAGGAGGAGGAAGAGGGGGG + Intronic
1161684978 19:5698120-5698142 TGGGAGGAGCTGGAGGAGGTGGG - Intronic
1161972007 19:7587391-7587413 TTCGAGGAGGAGGGAGAGGTAGG - Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163478942 19:17543179-17543201 TGGGACAAGGAGGAGGAGGTTGG + Intronic
1163500635 19:17674206-17674228 TTGGAGAAAGGGGCAGAGGTGGG + Intronic
1163610099 19:18296159-18296181 TAGGAGAACAAGGAAGAGATAGG - Intergenic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163737697 19:18991488-18991510 TTGGAGGAGCGGCAGGAGGTGGG + Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1165347796 19:35259712-35259734 TTGGGGATGTAGCAAGAGGTGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166666797 19:44684940-44684962 GTGGGGAAGGAGGAAAAGGTGGG + Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167608096 19:50492507-50492529 GTGGACAATCAGGAAAAGGTGGG + Intergenic
1168284349 19:55322990-55323012 TTGGGGAAGGAGGAAGGAGTTGG - Intronic
1168296017 19:55377653-55377675 CCGGAGACGCAGGCAGAGGTTGG - Exonic
1168434723 19:56307961-56307983 TTAGAGAAGCAGGAGGAGCTTGG - Intronic
1168503580 19:56914186-56914208 GCGGAGAAGGAGGAAGAGGAGGG + Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925639115 2:5970619-5970641 TTGGAGAGGCAGGAAGAATATGG - Intergenic
925733962 2:6944175-6944197 TTGGAGATGCGGGAGGAGGCCGG + Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926591866 2:14749124-14749146 TTGGACAAGCAGGAGAAGGTTGG + Intergenic
926602919 2:14865324-14865346 TTGGGGAAGCAGGTGGGGGTGGG + Intergenic
926908292 2:17826251-17826273 TTGGAGGAGCAGGGAAAGGAGGG + Intergenic
926975588 2:18513919-18513941 GTGGAGGAGTAGGAAAAGGTGGG - Intergenic
927123342 2:19989821-19989843 TGGGAACCGCAGGAAGAGGTCGG + Intronic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927416727 2:22887841-22887863 GGGGAGGAGGAGGAAGAGGTGGG + Intergenic
927500503 2:23579769-23579791 TTGGTGAAGCCAGAAGAGGTGGG - Intronic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929938085 2:46309565-46309587 TTGGAGGAGCATGAAGACCTAGG + Intronic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930940799 2:57012494-57012516 CTGGAGCAGGAGGAAGAGTTGGG - Intergenic
931105218 2:59047916-59047938 TGGGAGAAACAGGAAAATGTGGG + Intergenic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
931817435 2:65918699-65918721 TTGGAGAGGCAGGCATATGTTGG - Intergenic
932436311 2:71704341-71704363 TTGGGGAGGCAGGAAGATCTGGG + Intergenic
932593595 2:73081087-73081109 GAGGAGGAGGAGGAAGAGGTGGG - Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932819903 2:74890783-74890805 TTGGCAAAGCTGGAAAAGGTGGG - Exonic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935656723 2:105429541-105429563 TTCCAGAAGCTGGAAAAGGTGGG + Intronic
935944952 2:108277349-108277371 TTGGAGGTGGAGGCAGAGGTGGG - Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936632354 2:114216981-114217003 TTGGCTAAGGAGGGAGAGGTGGG + Intergenic
937077969 2:119120863-119120885 TAGGAGGATCAGGAAGAGTTTGG + Intergenic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937917202 2:127105208-127105230 TTGGGGAGCCAGGAAGGGGTGGG + Intronic
939825851 2:147014901-147014923 GAGGAGGAGGAGGAAGAGGTGGG - Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
942254270 2:174078062-174078084 TTGGAACACCAGGAAGAGGAGGG - Intronic
942287993 2:174440759-174440781 TGGGGGTAGGAGGAAGAGGTCGG - Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943330681 2:186555381-186555403 ATGCAGAAGCAGGAAGGGCTTGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944275092 2:197827301-197827323 TGTGAGAAGTAGGAAGTGGTAGG - Intronic
944516096 2:200513107-200513129 TTGGTGAGGCAGGAAGGGGAGGG + Intronic
944841063 2:203624172-203624194 GTGAAGATGCAAGAAGAGGTTGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945427914 2:209730109-209730131 TGGGAGATGGAGAAAGAGGTAGG + Intronic
945873150 2:215249130-215249152 TTGGAGAAGGAGGAAGATAGAGG - Intergenic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
946410173 2:219511717-219511739 TGGGGGAAGCAGGGAGGGGTGGG + Intergenic
946493706 2:220174572-220174594 TTGGAGGGGAAGGAAGAGCTGGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947103445 2:226645826-226645848 TTGGAGCAGCAGCAATAGGTTGG - Intergenic
947137061 2:226985860-226985882 CTGGATAAACTGGAAGAGGTAGG - Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947895732 2:233670242-233670264 GCTGAGAAGGAGGAAGAGGTGGG + Intronic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
948710386 2:239821622-239821644 TTGGGGAGGCAGAAAGCGGTGGG - Intergenic
1169211022 20:3766489-3766511 TTGGGGAGGCAGGAAGGTGTGGG - Intronic
1169249374 20:4048505-4048527 TGGGAAAAGCCGGAAGAAGTTGG + Intergenic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171307881 20:24121397-24121419 TTGGAGGAGAAGGAATAGATTGG + Intergenic
1171777520 20:29382958-29382980 TTGGGTAAACAGGCAGAGGTTGG - Intergenic
1171818807 20:29813646-29813668 TTGGATAAACAGGCAGAAGTTGG - Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173145542 20:40521095-40521117 TAGGAGGAGCAGGGAGGGGTGGG - Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1175705611 20:61174432-61174454 TTGGTGCAACAGGAAGAAGTAGG - Intergenic
1175853277 20:62104969-62104991 TTGGGAAAGGAGGAAGAGTTAGG + Intergenic
1176986502 21:15443535-15443557 TTGGAGAAGAAAGAAAAGGGTGG + Intergenic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1177734679 21:25073741-25073763 ATGCAGAAGCTGGAAGAGCTTGG - Intergenic
1177858995 21:26430577-26430599 GTGGAGAAGCAGGAAAACCTGGG - Intergenic
1177937642 21:27368974-27368996 TTGGTGAGGCAGGAATAGTTGGG + Intergenic
1178033635 21:28556273-28556295 TTGGAGTACCTGGAAGAGATGGG + Intergenic
1178250284 21:30997376-30997398 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179592163 21:42415980-42416002 TTGGTGAAGCAGGAAGTCCTGGG - Intronic
1180119925 21:45739397-45739419 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180119943 21:45739452-45739474 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180144796 21:45913053-45913075 TTGGTCCAGCAGGAAGAGGTGGG - Intronic
1180708498 22:17824117-17824139 TTGCACCAGCAGGAAGAGGGCGG + Intronic
1180723547 22:17927598-17927620 CTGGAGCAGCAGGCAGATGTCGG - Intronic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181426916 22:22849709-22849731 TTGGAGGAGGAGGAAGATGATGG + Intronic
1182453132 22:30432923-30432945 GAGGAGAAGCAGGAAAAGCTAGG - Intergenic
1182456589 22:30455658-30455680 TTGGGGAAGGAGTAAGAGGCAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1183131448 22:35840510-35840532 TGGGGGGAGGAGGAAGAGGTGGG - Intronic
1183272251 22:36869534-36869556 TGGGGGCAGCAGGATGAGGTGGG - Intronic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949369157 3:3316311-3316333 GAGGAGAAGGAGGAAGAGATAGG - Intergenic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949669965 3:6388347-6388369 TCTGAGAAGCAGGAAAACGTTGG + Intergenic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950430436 3:12947820-12947842 CTGGAGAAGGGGGAAGAGCTTGG - Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
951816005 3:26755655-26755677 TTGGGGAATTAGGATGAGGTGGG + Intergenic
952331339 3:32367039-32367061 TTGGAGACAGAGGAAGGGGTAGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953653532 3:44828369-44828391 CTGGAGGTGCAAGAAGAGGTAGG - Intronic
954266220 3:49472172-49472194 GTGGAGTGGCAGGAAGAGGGAGG + Intronic
954684681 3:52364044-52364066 TTGGAGCTGCATGAAGAGGCTGG - Intronic
954745018 3:52782838-52782860 GTGGACAAGCAGGAGGAGATAGG - Intronic
955520515 3:59771213-59771235 TTGCAGAAGGAAGAACAGGTGGG + Intronic
955545898 3:60029820-60029842 TTGTAGCACCAGAAAGAGGTTGG + Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957578514 3:82040017-82040039 TTGTAGAAACAGGAACAGGCTGG - Intergenic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
959092136 3:101914696-101914718 TAGGAGAAACAGGAAAATGTTGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959817979 3:110698505-110698527 TTTGAGAATCAGGAACAAGTGGG - Intergenic
959933073 3:112003356-112003378 GCAGAGAAGCAGGAAGAGGGAGG + Intronic
960010645 3:112830995-112831017 TTGGGGAAGGAGGAATAGGGGGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961303115 3:125934760-125934782 TTGGGGAAGCCGGGAGAGGAGGG - Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962143575 3:132816890-132816912 TTGGGGAACCAGGAACAGGCTGG + Intergenic
962611564 3:137081546-137081568 TGAGAGAAACAGGAAGAAGTTGG + Intergenic
962820456 3:139043909-139043931 TCGGAGAGGGAGGTAGAGGTTGG + Exonic
963009492 3:140755891-140755913 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
963018570 3:140849529-140849551 TTGGAGGAGAAGGTAGAGGAAGG - Intergenic
963304145 3:143631754-143631776 TTGGAAAAACTGGAAGATGTAGG - Intronic
963460090 3:145601413-145601435 GTGAAGATGCAGGTAGAGGTTGG + Intergenic
964310448 3:155386433-155386455 TTGAGGAGGCAGGAAGAGATGGG - Intronic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965442922 3:168738552-168738574 TTAGAGAAGCAGGACAAGGCAGG + Intergenic
965807535 3:172557536-172557558 TGGCTGAAGAAGGAAGAGGTTGG + Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966277869 3:178197502-178197524 TTGAAGAAGCGGGAATGGGTTGG + Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
967154502 3:186680189-186680211 CTGGAGAAGAATGAAGAGTTTGG - Intergenic
967305252 3:188052806-188052828 TGGGGGAAACAGGAAGAGCTAGG - Intergenic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
968139940 3:196247580-196247602 TGGGAGAAGATGGGAGAGGTCGG - Intronic
968456379 4:702688-702710 TTGGGGAAACAGGCAGAGGTGGG + Intergenic
968615064 4:1573993-1574015 TTGGGGATGCAGGAAGAGCTGGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968942072 4:3644091-3644113 TGGAAGAGGCAGGAAGAGGAAGG + Intergenic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969819783 4:9711023-9711045 TTGGGGAAGCTGGGAGAGGAGGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970715600 4:18918683-18918705 TTCGAGAAGCAGAAATAGCTGGG - Intergenic
971026268 4:22591334-22591356 TGGCAGAGGCAGGGAGAGGTAGG - Intergenic
971495206 4:27256910-27256932 TTGGAGAAGATAGAAGAGTTAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971746298 4:30585857-30585879 TTGGAGTAGCTGAAAGAGATGGG - Intergenic
973543167 4:51954315-51954337 TTGGAGCAGGAGGAAGAGAGAGG - Intergenic
974220184 4:58958869-58958891 TTAGATAAGGTGGAAGAGGTCGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
976150161 4:82083632-82083654 TTAGAGAAGCAGGAACTTGTGGG + Intergenic
976761785 4:88557080-88557102 AGGGAGAGGAAGGAAGAGGTGGG - Intronic
977069637 4:92368293-92368315 CTTGAGAAGCATTAAGAGGTAGG + Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978430557 4:108628564-108628586 TTGGAGCAGCAAGGAGAGGGAGG - Intronic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979267560 4:118720947-118720969 TTGGAGAAGCAAGTAGAGTGAGG - Intergenic
979817102 4:125122641-125122663 TTGGGGATGCAGGAAGATGAAGG + Intergenic
980054041 4:128062409-128062431 AGGGAGCGGCAGGAAGAGGTGGG + Intronic
980325520 4:131339948-131339970 TTAGAGAAATAGGAAGAAGTAGG + Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981104179 4:140862089-140862111 TTGGAGAAGCAGGGTAATGTGGG - Exonic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981862335 4:149371676-149371698 TTGGAGAATCAGGGACAGTTAGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
982709287 4:158744100-158744122 TTGTAGTTGCAGGAAGAGGAAGG + Intergenic
983010619 4:162540891-162540913 TTGGAGTCTCAGGAAGAGATAGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
983806554 4:172000537-172000559 TTGCCGAAGCAGGGAAAGGTGGG + Intronic
984140384 4:175998396-175998418 TTTGAGAGGCAGGACGAGCTGGG - Intronic
984213632 4:176880689-176880711 TTGGGAAAGCAAGAAGATGTGGG + Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985443292 4:190001035-190001057 TTGGATAAACAGGCAGAGGTTGG - Intergenic
985475495 5:76698-76720 TAGGAGGAGGAGGAAGAGATGGG + Intergenic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986285345 5:6354669-6354691 TGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986652595 5:9979431-9979453 GTGGAGAGGCAGGAGGTGGTGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987116725 5:14731658-14731680 TTAGAGAATCAGGGAGAGGCTGG + Intronic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987778595 5:22401859-22401881 GTGGAGAAGGAAGAAGAGATTGG + Intronic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
989118660 5:37981558-37981580 TTGGAAAGGTAGGAAGTGGTAGG + Intergenic
989166017 5:38434198-38434220 TTGTAGAAACTGGAAGACGTTGG - Intronic
989345504 5:40425032-40425054 TTAGAGAAGGAGAAAGAGTTTGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
990874498 5:60468926-60468948 TTGAAGATGCAGGAAATGGTGGG - Intronic
991509016 5:67356323-67356345 TTGGAGCAGTAGGAAAAGATTGG - Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992472315 5:77070171-77070193 TTGGAGAATGAGGAGGAGATTGG + Intergenic
992759202 5:79936732-79936754 TGGTAGGAGCAGGAAGAAGTGGG + Intergenic
992788320 5:80190939-80190961 TTGGTGATCCAGGAAGAAGTGGG - Intronic
992840634 5:80687976-80687998 GTGGAGAACCAGGACAAGGTAGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993591137 5:89796474-89796496 TTGTAGCAGCATTAAGAGGTGGG + Intergenic
993625448 5:90219321-90219343 GAGGAGGAGGAGGAAGAGGTGGG + Intergenic
993926200 5:93869411-93869433 TTGAAGAATTAGGAAGAGCTTGG + Intronic
994863734 5:105235236-105235258 TTGGAGGAGCAGGCAGTGGGAGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997392273 5:133526745-133526767 TGGGAGTAGCAGGAGGAGATGGG + Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997551882 5:134760414-134760436 TTTGAGAAGTAGTAGGAGGTAGG + Intronic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997625113 5:135326407-135326429 GTTTAGAGGCAGGAAGAGGTAGG - Intronic
997937485 5:138126121-138126143 TTTGAGAAGCAGCAAGTTGTAGG - Intronic
998040384 5:138947600-138947622 TTGGGGATAGAGGAAGAGGTGGG - Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998391282 5:141788536-141788558 TAGGAGAAAAAGGAGGAGGTGGG - Intergenic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1002995369 6:2278118-2278140 TTGGAGAAACATGAAGACGTTGG - Intergenic
1003545232 6:7052590-7052612 TGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1004525056 6:16399779-16399801 TTGGGGAAGCAGGGAGATGGAGG - Intronic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1005882156 6:30070068-30070090 TGGGAGAGGAAGGAAGAGGGAGG + Exonic
1005990413 6:30898644-30898666 GAGGAGCAGAAGGAAGAGGTGGG + Intronic
1006116037 6:31776685-31776707 TTGGGGAAGAAGGCAGATGTGGG + Exonic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006478568 6:34273711-34273733 TTGGAGCAGGTGGAGGAGGTGGG - Intergenic
1007091677 6:39188721-39188743 TTTGAGAATCAGGAAGGAGTGGG - Intergenic
1007444338 6:41894158-41894180 TGAGAGGAGCAGGAAGAGATGGG - Exonic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008125082 6:47659018-47659040 TTGGACAAGAAGAAAGAGATGGG - Exonic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1011043103 6:83052653-83052675 TTGGGGGAGGAGGAATAGGTTGG + Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011866448 6:91834658-91834680 AAGGAGAAGCAGGCAGAGATAGG + Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012944086 6:105447805-105447827 TTGGAAATGCAGGTAGAGGGGGG - Intergenic
1012952257 6:105530735-105530757 TCGGAAAAGCAGGAAGTGATAGG + Intergenic
1013461683 6:110380105-110380127 TTGGAGTACCAGAAAGAGATAGG + Intergenic
1014084932 6:117331366-117331388 TTGGAGTACCAGGAGGAGATGGG + Intronic
1014153705 6:118087624-118087646 TTGGAGAGGTAGGCAGAGGAGGG - Intronic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1016474073 6:144407006-144407028 TCAGACAAGCAGGAAGGGGTAGG - Intronic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017602164 6:156095481-156095503 GAGGAGGAGGAGGAAGAGGTGGG - Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018377861 6:163230879-163230901 TTGGAGAGAGAGGAGGAGGTAGG + Intronic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019020394 6:168913080-168913102 TTGGATAGGCAGGAACAGGAGGG - Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1021003281 7:15360580-15360602 GAGGAGGAGGAGGAAGAGGTGGG + Intronic
1021316823 7:19157934-19157956 TCTGATAAGCAGGAGGAGGTAGG + Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1021949811 7:25763682-25763704 GTGGAGAAAGAGGAAGAGCTAGG - Intergenic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1023042242 7:36181896-36181918 TTGGAGAAGGAGTAACAGATGGG - Intronic
1023991269 7:45130202-45130224 TGGGGGAAGCAGGGAGGGGTTGG - Intergenic
1024775828 7:52784312-52784334 CTGGAGAATCAGGAAAAGATTGG + Intergenic
1024913207 7:54469873-54469895 TTGGAGAAGCAGCCAGAGCCAGG + Intergenic
1025008413 7:55374545-55374567 TGGGAAAAGCAGGCAGGGGTGGG - Intronic
1026073458 7:67143546-67143568 TTGCGGAAGCAGGCAGAGTTTGG + Intronic
1026205746 7:68255695-68255717 GAGAAGAAGGAGGAAGAGGTGGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026703428 7:72668632-72668654 TTGTGGAAGCAGGCAGAGTTTGG - Intronic
1026718831 7:72813470-72813492 TTAGAGAAGCAGTTAGAGGCTGG - Intronic
1026735328 7:72945386-72945408 TGGGAGAAGCAGGCTGAGCTGGG + Intronic
1026747116 7:73022276-73022298 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026750766 7:73050419-73050441 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026754415 7:73078529-73078551 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026758067 7:73106562-73106584 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1026785668 7:73300316-73300338 TGGGAGAAGCAGGCTGAGCTGGG + Intergenic
1027033219 7:74906847-74906869 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1027089338 7:75286922-75286944 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027092981 7:75314850-75314872 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027096624 7:75342817-75342839 CTGGAGGAGTTGGAAGAGGTGGG + Intergenic
1027108398 7:75419620-75419642 TGGGAGAAGCAGGCTGAGCTGGG - Intronic
1027243084 7:76346004-76346026 TGAAAGAACCAGGAAGAGGTGGG - Intronic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1027322723 7:77024863-77024885 CTGGAGGAGTTGGAAGAGGTGGG - Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029248338 7:99218604-99218626 GTGGATAAGGAGGAAGTGGTAGG - Intergenic
1029733386 7:102452068-102452090 GTGGGGCAGCAGGAACAGGTGGG + Exonic
1030577834 7:111312182-111312204 TTAGAGAAAGAAGAAGAGGTTGG + Intronic
1030769774 7:113459819-113459841 ATGGAGAAGTAGGAAGTAGTGGG - Intergenic
1031806550 7:126314891-126314913 TTGGAGAAGCATGAATAGATTGG + Intergenic
1032128596 7:129211850-129211872 TCGGAGGAGGAGGAAGAGGAAGG + Intronic
1032521776 7:132550930-132550952 ATGCAGGAGAAGGAAGAGGTGGG - Intronic
1033682131 7:143604872-143604894 TTGGGGAGGTAGGCAGAGGTGGG + Intergenic
1033702759 7:143857041-143857063 TTGGGGAGGTAGGCAGAGGTGGG - Intronic
1034337382 7:150332257-150332279 TGGGAGAAGAAGGAAGGGGGTGG + Exonic
1034487543 7:151375268-151375290 TTGGAGAAATATTAAGAGGTGGG + Intronic
1035108787 7:156463418-156463440 TGGGAGCAGGGGGAAGAGGTGGG + Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035609138 8:948685-948707 CTGGAGCAGCAGGGAGACGTGGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036952939 8:13159036-13159058 TTAGTGAAGCAGGCAGAGATAGG + Intronic
1037744622 8:21632875-21632897 TTGAAGAGACTGGAAGAGGTTGG - Intergenic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1038713136 8:29967183-29967205 CTGGAGCAGGAGGAAGAGCTGGG + Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1040045117 8:42954958-42954980 TTCGAGAAGCAGGAACAGTGTGG + Intronic
1040624101 8:49125719-49125741 GAGGAGAAGCAGGAAGGGATCGG - Intergenic
1041220856 8:55649477-55649499 TTGGAGAAGCAGGGAGCATTAGG + Intergenic
1041472525 8:58226185-58226207 TTTGAAAAGTAGGAAGAAGTAGG - Intergenic
1041602093 8:59731122-59731144 GAGGAGGAGGAGGAAGAGGTTGG - Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042940525 8:74102812-74102834 TTTGACAAGCAGGAGCAGGTGGG + Intergenic
1042944212 8:74138482-74138504 TTGGAGTAGGAAGGAGAGGTAGG - Intergenic
1042962405 8:74318148-74318170 TTTGAGCAGCAGGGAGAAGTTGG - Intronic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043499488 8:80838618-80838640 CTGGAGGAGGAGGAAGAGTTAGG + Intronic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043817722 8:84823630-84823652 TAAGAGAAGAAGGCAGAGGTGGG - Intronic
1044401958 8:91783077-91783099 TTTGAGAATCAGGAAGAGACAGG - Intergenic
1044561219 8:93614042-93614064 TTGCAAAACCAGGAAGTGGTAGG - Intergenic
1044630181 8:94270895-94270917 TTTGGGAGACAGGAAGAGGTGGG - Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045832144 8:106475411-106475433 GAGGAGGAGGAGGAAGAGGTGGG + Intronic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1046739734 8:117815324-117815346 ATGGAGAATGAGGAAGATGTAGG + Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047891717 8:129319137-129319159 TGGGGGATGGAGGAAGAGGTGGG + Intergenic
1048049673 8:130805537-130805559 TTGGAGAAGTGGGAATAGGGTGG + Intronic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049675830 8:143888608-143888630 CTGAAGGAGCAGGGAGAGGTCGG + Intergenic
1049698719 8:143996776-143996798 TTGGGGAAGCAGGTAGAAGAAGG + Intronic
1050201503 9:3149875-3149897 TTGGAGGTGGAGGCAGAGGTGGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050776555 9:9269858-9269880 TTGGGGAAACAGGGAGATGTTGG + Intronic
1053169123 9:35865981-35866003 TAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053385296 9:37682381-37682403 TTGGACATCCAGGAAGATGTTGG + Intronic
1054331125 9:63756773-63756795 GTGAAGAAGAAGGAAGAGATTGG - Intergenic
1054408032 9:64778911-64778933 TAGGAGGAGGAGGAAGAGGGAGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1056589619 9:87955634-87955656 TTAGAGAGACAGGAAGAGGCAGG - Intergenic
1057495036 9:95553846-95553868 GTGGAGAGGCAGGCAGAGATTGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057879800 9:98784576-98784598 TTTCAGATGCAGGAAGAGCTAGG + Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1059061073 9:111036495-111036517 TTAGAGCAGTAGGAAAAGGTAGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1060415311 9:123425781-123425803 TTGGAGAAGTCGGTGGAGGTGGG + Intronic
1061057461 9:128232175-128232197 TTGGAGGAGCAGGGAGAAGGAGG - Intronic
1061329086 9:129881031-129881053 TTGGAACACCAGGAGGAGGTTGG + Exonic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1062578973 9:137221413-137221435 TGGGAGGAGGAGGAAGGGGTGGG + Intronic
1062739928 9:138165933-138165955 TTGGGTAAACAGGCAGAGGTTGG + Intergenic
1203370468 Un_KI270442v1:298915-298937 TTGGATAAACAGGCAGAAGTTGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186350251 X:8732409-8732431 TGGGAGGGGCAGGAAGCGGTTGG - Intergenic
1186735262 X:12456490-12456512 TTGGAGGAGGGGGTAGAGGTGGG - Intronic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187834362 X:23416142-23416164 TCCAAGGAGCAGGAAGAGGTGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1189081179 X:37974050-37974072 TAGGAGAAACAGGGAGATGTTGG + Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189193544 X:39132738-39132760 TTGAAGATGGAGGAAGAGGTAGG - Intergenic
1189225459 X:39409666-39409688 CTTGAAAAGCAGGTAGAGGTCGG + Intergenic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1192529824 X:71874519-71874541 TTGGGGAGGCTGGGAGAGGTGGG - Intergenic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194294219 X:92108758-92108780 TTTGATAAGCCGTAAGAGGTAGG + Intronic
1194596872 X:95869144-95869166 TTGGAGTAGTAGGAGGAGATGGG + Intergenic
1194615391 X:96095098-96095120 TGTGAGAAGCAGGGAGAGGTAGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1197362469 X:125522717-125522739 CTGTAGAACCAGGAAGAGCTGGG + Intergenic
1197843951 X:130780732-130780754 TTGTAGAAAATGGAAGAGGTAGG + Intronic
1197947074 X:131851155-131851177 TAGCAGAAGCAGGAAGAGAGCGG - Intergenic
1199049576 X:143221366-143221388 CTGGAGCAGGAGGAAGAGATGGG - Intergenic
1199597364 X:149516738-149516760 TCGGGGAAGCAGGGAGAGGTGGG - Intronic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200532994 Y:4359890-4359912 GTAGAGACACAGGAAGAGGTGGG + Intergenic
1200611724 Y:5333277-5333299 TTTGATAAGCCGTAAGAGGTAGG + Intronic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200832025 Y:7695318-7695340 TTGGGGAAGTAGAAAAAGGTTGG + Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201416166 Y:13751450-13751472 TAGGAGGGGCAGGAAGCGGTTGG + Intergenic