ID: 992973193

View in Genome Browser
Species Human (GRCh38)
Location 5:82083589-82083611
Sequence CAGTTGTATGAGGGGTCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 6, 2: 90, 3: 169, 4: 490}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992973193_992973202 7 Left 992973193 5:82083589-82083611 CCAACTGACCCCTCATACAACTG 0: 1
1: 6
2: 90
3: 169
4: 490
Right 992973202 5:82083619-82083641 CTCTGACACGAAGCTTCCAGAGG 0: 2
1: 350
2: 1170
3: 3579
4: 1858
992973193_992973203 11 Left 992973193 5:82083589-82083611 CCAACTGACCCCTCATACAACTG 0: 1
1: 6
2: 90
3: 169
4: 490
Right 992973203 5:82083623-82083645 GACACGAAGCTTCCAGAGGAAGG 0: 3
1: 201
2: 817
3: 1501
4: 1097
992973193_992973204 17 Left 992973193 5:82083589-82083611 CCAACTGACCCCTCATACAACTG 0: 1
1: 6
2: 90
3: 169
4: 490
Right 992973204 5:82083629-82083651 AAGCTTCCAGAGGAAGGATCAGG 0: 978
1: 1673
2: 2104
3: 1348
4: 926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992973193 Original CRISPR CAGTTGTATGAGGGGTCAGT TGG (reversed) Intronic
901716798 1:11161543-11161565 CAGCCGTGTGAGGTGTCAGTCGG - Intronic
903357793 1:22758712-22758734 CAGTGGTATGAGGGGCAAGCTGG + Intronic
905455328 1:38084365-38084387 CAGTTGTTTCTGGGCTCAGTTGG - Intergenic
905962917 1:42059987-42060009 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
906077783 1:43064836-43064858 CAGTTTCTTGAGGGGTGAGTAGG - Intergenic
906570086 1:46830564-46830586 CACCTGTATGAGGTGTCTGTTGG + Intergenic
906585800 1:46976701-46976723 CAGCTGTATGAGGTGTGTGTTGG - Intergenic
906834967 1:49073665-49073687 CTCTTGTATGAGGGGTCTGTTGG + Intronic
907778133 1:57538844-57538866 GAGTTGTAGGGGGGGTGAGTGGG - Intronic
907978849 1:59460656-59460678 CAGCTGTATGAGATGTCAGTCGG - Intronic
907994079 1:59611272-59611294 TGGTTGTATGAGGTGTCAGTCGG - Intronic
908595554 1:65685555-65685577 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
909453977 1:75829544-75829566 CAGCTGTATGAGGTGTCAGTCGG - Intronic
909668204 1:78159427-78159449 CGGCTTTATGAGGTGTCAGTTGG - Intergenic
909682730 1:78310771-78310793 TGGCTGTATGAGGTGTCAGTCGG - Intronic
909770440 1:79414900-79414922 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
910383657 1:86658173-86658195 CAGCTGTATGAGGTGTCACTTGG - Intergenic
910612022 1:89154958-89154980 CGGCTGTTTGAGGTGTCAGTCGG - Intronic
910717449 1:90247708-90247730 CAGCTGCATGAGGTGTCAGTCGG - Intergenic
910940694 1:92530513-92530535 CTCTTGTATGAGGTGTCTGTTGG - Intronic
911128939 1:94369684-94369706 CACCTGTATGAGGTGTCAGTTGG + Intergenic
911213118 1:95163885-95163907 CAGCCATATGAGGTGTCAGTCGG + Intronic
911217912 1:95216119-95216141 CTATTGTATGAGGTGTCTGTCGG + Intronic
911339212 1:96617250-96617272 CACCTGTATGAGGTGTCAGTTGG + Intergenic
911517134 1:98880994-98881016 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
911963588 1:104337755-104337777 CAGCTGTGTGAGGTGTCAGTCGG + Intergenic
912463286 1:109851789-109851811 CGCCTGTATGAGGTGTCAGTTGG - Intergenic
913607454 1:120478908-120478930 CACTTGTATGAGGTGTCTGTCGG - Intergenic
913692443 1:121292009-121292031 CAGTTTTATGTGGGGTAGGTAGG + Intronic
914145114 1:144988093-144988115 CAGTTTTATGTGGGGTAGGTAGG - Intronic
914208971 1:145561231-145561253 CACCTGTATGAGGTGTCTGTCGG + Intergenic
914441479 1:147711454-147711476 CACCTGTATGAGGTGTCAGTTGG + Intergenic
914583738 1:149042926-149042948 CACTTGTATGAGGTGTCTGTCGG + Intronic
915088907 1:153407726-153407748 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
915613428 1:157014657-157014679 CAGTGGATTGAGGGGTAAGTGGG - Intronic
915631060 1:157154577-157154599 CAGCTGTGTGTGGGGACAGTGGG + Intergenic
916038330 1:160941290-160941312 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
916251922 1:162746727-162746749 CAGCTGTATGAGGTGTCTGTAGG - Intronic
916373529 1:164126339-164126361 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
916469452 1:165108941-165108963 CGCCTGTATGAGGGGTCTGTCGG + Intergenic
916534546 1:165691117-165691139 CACCTGTATGAGGTGTCAGTCGG - Intronic
916915432 1:169401407-169401429 CGGCTGTATGAGGTGTCAGTTGG - Intronic
917192476 1:172432343-172432365 CACCTGTATGAGGTGTCAGTCGG - Intronic
917308738 1:173655507-173655529 CACCTGTATGAGGTGTCAGTCGG + Intronic
917764090 1:178198708-178198730 TGGTTGTATGAGGTGTCAGTTGG + Intronic
918646777 1:186915235-186915257 CAGCTGAAGGAGGGGTCTGTGGG - Intronic
918832481 1:189416012-189416034 CGGCTGTATGAGGTGTCAGTTGG + Intergenic
918890287 1:190257874-190257896 CACCTGTATGAGGTGTCAGTTGG + Intronic
919065435 1:192688109-192688131 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
919203241 1:194386819-194386841 CAGTAGAATTTGGGGTCAGTGGG + Intergenic
920479764 1:206310366-206310388 CAGTTTTATGTGGGGTAGGTAGG + Intronic
921469661 1:215532958-215532980 GAGCTGTATGAGGTGTCAGTTGG - Intergenic
922641081 1:227232795-227232817 CGGCTGTATGAGGTGTCAGTCGG + Intronic
923194411 1:231651478-231651500 CGCCTGTATGAGGTGTCAGTCGG + Intronic
923465986 1:234248169-234248191 CCATTGTTTGATGGGTCAGTTGG + Intronic
923466004 1:234248253-234248275 CCATTGTTTGATGGGTCAGTTGG + Intronic
923466023 1:234248337-234248359 CCATTGTTTGATGGGTCAGTTGG + Intronic
923466035 1:234248393-234248415 CCATTGTTTGATGGGTCAGTTGG + Intronic
923466046 1:234248449-234248471 CCATTGTTTGATGGGTCAGTTGG + Intronic
923466056 1:234248505-234248527 CCATTGTTTGATGGGTCAGTTGG + Intronic
1064431134 10:15270635-15270657 CAGCCGTATGAGGTGTCAGTCGG - Intronic
1064518583 10:16176984-16177006 CACCTATATGAGGTGTCAGTTGG + Intergenic
1064682520 10:17825354-17825376 CAGTTACATGATGTGTCAGTGGG + Intronic
1065364651 10:24923400-24923422 CACCTGTATGAGGTGTCTGTCGG - Intronic
1065679277 10:28212487-28212509 CAGTTGAATATGGGGTCAGCAGG + Intronic
1066163056 10:32755375-32755397 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1067335509 10:45359478-45359500 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1068131470 10:52900678-52900700 CTGATGTATGAGGGGTCTGGTGG + Intergenic
1068161544 10:53271591-53271613 CAGTTGTATAAGGGGGCTGAAGG - Intergenic
1068214732 10:53968610-53968632 CGGCTATATGAGGTGTCAGTCGG - Intronic
1068609476 10:59043250-59043272 CACCTGTATGAGGTGTCTGTCGG + Intergenic
1068821177 10:61378738-61378760 CAGTTGTATGAGGTGTCAGTTGG + Intergenic
1068845736 10:61671381-61671403 CACTTGGCTGAGGGGTGAGTGGG + Intronic
1070217592 10:74403126-74403148 CAGTTGTATGAGGTGTCTGTTGG + Intronic
1070387657 10:75940342-75940364 CAGATGCATGAGGGGACAGGTGG - Intronic
1070851910 10:79571102-79571124 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1071698429 10:87903240-87903262 CGGCTGTATGAGGTGTCAGTCGG + Intronic
1071838632 10:89445333-89445355 TGGCTGTATGAGGTGTCAGTTGG - Intronic
1071884665 10:89936906-89936928 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1072374440 10:94800415-94800437 CACGTGTATGAGGTGTCTGTTGG + Intronic
1072379954 10:94857915-94857937 CACCTTTATGAGGTGTCAGTCGG + Intergenic
1072394271 10:95022869-95022891 CATCTGTATGAGGTGTCAGTTGG + Intergenic
1072516177 10:96185702-96185724 CGGCTGTATGAGGTGTCAGTCGG + Intronic
1072929148 10:99645944-99645966 CAGCCATATGAGGTGTCAGTCGG + Intergenic
1073022299 10:100455199-100455221 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
1073456835 10:103642063-103642085 CAGCTTTATGATGGGTCATTGGG - Intronic
1074000559 10:109367981-109368003 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1074017346 10:109547018-109547040 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1074782861 10:116814608-116814630 CAGCTGGATGAGGGGTCATCAGG - Intergenic
1075571955 10:123552630-123552652 CAGTTGTATGAGGAGGCTGGGGG + Intergenic
1076159139 10:128228971-128228993 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1077710538 11:4532155-4532177 CAGCTGTATGAGATGTCAGTTGG - Intergenic
1077741836 11:4854821-4854843 CAGCTGTAAGAGGTGTCAGTTGG - Intronic
1078121710 11:8517090-8517112 CGGCTGTATGAGGTATCAGTTGG - Intronic
1078681488 11:13480679-13480701 AAGCTGTATGAGGTGTCAGTCGG - Intergenic
1078994100 11:16679212-16679234 CACCTGTATGAGGTGTCTGTTGG - Intronic
1079307313 11:19334599-19334621 AAGTTTCGTGAGGGGTCAGTGGG - Intergenic
1080744005 11:35091380-35091402 CGCCTGTATGAGGTGTCAGTCGG - Intergenic
1080917456 11:36674148-36674170 CGGCTGTATGAGATGTCAGTCGG - Intergenic
1081768303 11:45628309-45628331 TGGCTGTATGAGGTGTCAGTAGG - Intergenic
1081946319 11:46997943-46997965 CAGCCGTATGAAGTGTCAGTCGG + Intronic
1083090286 11:60192316-60192338 CAGCTGAAGGAGGGGTCTGTAGG + Intergenic
1083165317 11:60881500-60881522 CGGTCGTATGAGGTGTCAGTTGG - Intergenic
1083503392 11:63132695-63132717 CACCTGTATGAGGTGTCTGTCGG + Intronic
1084911243 11:72391237-72391259 CAGTTGAAGGAGGGGACAGCAGG - Intronic
1085348288 11:75782070-75782092 CAGTGGTTTGAGGGGTGCGTAGG - Intronic
1086869015 11:92014930-92014952 CAGCTGTATTAGGTGCCAGTGGG + Intergenic
1086973064 11:93104385-93104407 CAGCTGAAGGAGGGGTCTGTAGG - Intergenic
1087100531 11:94359449-94359471 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1087219119 11:95526926-95526948 CCTTTGTAGAAGGGGTCAGTGGG - Intergenic
1087243477 11:95806977-95806999 CGGCTGTATGAGGTGTCAGTCGG - Intronic
1087718908 11:101639616-101639638 CAGCTGTATGAGGTGTCTATTGG - Intronic
1089192911 11:116667446-116667468 CAGCTCTATGAGGTGTCATTCGG - Intergenic
1090411451 11:126512520-126512542 CAGCCGTATGAGGGGTAAGTGGG + Intronic
1091814104 12:3423238-3423260 CAGCTGAAGGAGGGGTCTGTGGG - Intronic
1091867319 12:3851863-3851885 CGACTGTATGAGGTGTCAGTCGG - Intronic
1091958836 12:4672956-4672978 CCCTTGTATGAGGTGTCTGTTGG - Intronic
1092325766 12:7529272-7529294 CAGATCTATGAGGTGTCAGTCGG - Intergenic
1092562619 12:9632656-9632678 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1092638518 12:10478360-10478382 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
1092661867 12:10747626-10747648 CAACTGTATGAGGTGTCAGTCGG + Intergenic
1092711216 12:11339807-11339829 TGGTTGTATGAAGTGTCAGTCGG + Intergenic
1093008619 12:14080183-14080205 CGGCCGTATGAGGTGTCAGTCGG - Intergenic
1093649510 12:21626973-21626995 TAGCTGTATGAGGTGTCAGTTGG + Intergenic
1093717562 12:22400840-22400862 CAGGTGTATGAGGTGTCAGTTGG - Intronic
1093988392 12:25563527-25563549 CGGCTGTATGAGGTGTCAATTGG + Intronic
1094229467 12:28086274-28086296 CTGTTGTATGGGGATTCAGTAGG - Intergenic
1095140610 12:38657629-38657651 CAGCTGTATGAGGTGTCTATCGG - Intronic
1095186677 12:39208475-39208497 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1095306257 12:40642588-40642610 CTGCTGTATGAGGTGTCAGTAGG + Intergenic
1095442718 12:42254276-42254298 CACCTGTATGAGGTGTCTGTTGG + Intronic
1095913880 12:47457182-47457204 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1096950158 12:55460038-55460060 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1097033678 12:56107702-56107724 CTGTTTTATAAGGGGTCTGTAGG - Intronic
1097139533 12:56888609-56888631 TGCTTGTATGAGGTGTCAGTCGG - Intergenic
1097148583 12:56958971-56958993 CACCTGTATGAGATGTCAGTCGG - Intronic
1097301317 12:58022522-58022544 CACGTGTATGAGGTGTCTGTTGG + Intergenic
1097701067 12:62820498-62820520 CAGCCGTATGAGGTGTCAGTCGG - Intronic
1097973064 12:65655656-65655678 GAGTTGTGTGAGGGGAAAGTGGG - Intergenic
1098438707 12:70496633-70496655 CTTTTGTATGAGGTGTCTGTTGG + Intergenic
1098638447 12:72812951-72812973 CAGCTGTATGAGGTGTTAGTTGG + Intergenic
1098699498 12:73606450-73606472 AGGCTGTATGAGGTGTCAGTCGG - Intergenic
1098749045 12:74272172-74272194 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
1099025522 12:77460013-77460035 CGGCCGTATGAGGTGTCAGTTGG - Intergenic
1099428224 12:82550600-82550622 CAGCTATATGAGGTTTCAGTTGG + Intergenic
1099720601 12:86357080-86357102 CAGCCATATGAGGTGTCAGTCGG - Intronic
1099779182 12:87172145-87172167 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1100375074 12:94007705-94007727 CAACTGTATGAGGTGTCTGTTGG + Intergenic
1100381407 12:94065000-94065022 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1100463497 12:94823544-94823566 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1100748704 12:97673310-97673332 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1100907728 12:99321087-99321109 CGGTTGTATGAGGTGTCAGTTGG + Intronic
1100934966 12:99653378-99653400 CAGTTTTATGAGGGGAAAATAGG + Intronic
1101175185 12:102142874-102142896 CGGCCGTATGAGGTGTCAGTCGG + Intronic
1101460201 12:104883731-104883753 CGGCTGTATGAGGTGTCAGTTGG + Intronic
1101519958 12:105473066-105473088 CAGTTGTCTGGGGGCTCTGTTGG - Intergenic
1101636877 12:106551300-106551322 CAGCTGCATGAGGTGTCAGTTGG + Intronic
1102440295 12:112958727-112958749 CAGCCATATGAGGTGTCAGTCGG + Intronic
1103123844 12:118403823-118403845 CAGAGGTAAGAGGGGTCAGAGGG - Intronic
1103154615 12:118673991-118674013 CTCCTGTATGAGGTGTCAGTTGG + Intergenic
1103255375 12:119537808-119537830 CGCCTGTATGAGGTGTCAGTTGG + Intronic
1103908614 12:124339951-124339973 CAGGTGGATGGGTGGTCAGTAGG - Intronic
1104086340 12:125477843-125477865 CGGCTGTATGAGGTGTCAGTTGG - Intronic
1104639909 12:130460873-130460895 CAGTTGGGTGAGGGGACTGTGGG - Intronic
1105244021 13:18631599-18631621 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1105400999 13:20096015-20096037 CATTTGTAAGAGTAGTCAGTGGG - Intergenic
1106612220 13:31295229-31295251 CTGCTGTATGAGGAGTCTGTCGG + Intronic
1106737925 13:32607443-32607465 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1106980267 13:35271101-35271123 CACCTGTATGAGGTGTCTGTAGG - Intronic
1107724480 13:43284553-43284575 CAGTTGTCTGGTGGGTCAGCAGG + Intronic
1108264965 13:48697268-48697290 CAGCTGTATGAGGTGTCAGTCGG - Intronic
1108471692 13:50773665-50773687 CAGCTATATGAAGTGTCAGTGGG + Intronic
1108892434 13:55277959-55277981 CGGCTGTATGAGGTATCAGTCGG + Intergenic
1108988824 13:56629422-56629444 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1109228750 13:59729455-59729477 CAGTTGTGTGTGGGGTGAGGAGG + Intronic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109363310 13:61324304-61324326 CAGCTGTGTGAGGTGTCAGTTGG - Intergenic
1109566341 13:64120874-64120896 CAGCAGTATGAGGTGTCAGTCGG + Intergenic
1109659194 13:65436133-65436155 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1109850041 13:68050909-68050931 CATTTGTCTGAGGCTTCAGTTGG - Intergenic
1110606894 13:77443250-77443272 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1110767848 13:79300661-79300683 CCACTGTATGAGGTGTCAGTCGG - Intergenic
1111375085 13:87368116-87368138 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1112087537 13:96047228-96047250 CGGCTGTATGAGGTGTCAGTCGG - Intronic
1112131039 13:96524251-96524273 CACCTGTATGAGGTGTCTGTTGG + Intronic
1112232440 13:97602601-97602623 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1113300906 13:109018379-109018401 CAGCTGTATGAGGTGTCAGTCGG + Intronic
1113383772 13:109828764-109828786 CGGCTGTATGAGATGTCAGTTGG + Intergenic
1114240332 14:20860857-20860879 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1114432835 14:22677422-22677444 CGGCTGTACGAGGTGTCAGTCGG + Intergenic
1114796492 14:25720944-25720966 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1115010283 14:28537503-28537525 CATATGTATGTGGGGTCAGAGGG + Intergenic
1115294604 14:31812032-31812054 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1115362356 14:32517953-32517975 CAGCTGTATGAGGTGTCAGTCGG - Intronic
1115774332 14:36699340-36699362 CACCTATATGAGGGGTCTGTGGG + Intronic
1115833029 14:37363524-37363546 CACCTGTATGAGGTGTCTGTCGG + Intronic
1115843718 14:37502349-37502371 CGCTTGTATGAGGTGTCTGTCGG - Intronic
1115869674 14:37786008-37786030 CGGCTGTATGAGGCGTCTGTTGG + Intronic
1115954689 14:38764769-38764791 AGGCTGTATGAGGTGTCAGTCGG - Intergenic
1116240659 14:42338608-42338630 CAGCTGAAGGAGGGGTCTGTGGG - Intergenic
1116634508 14:47377968-47377990 CAGCTGTATGAGATGTCAGTTGG - Intronic
1116729814 14:48607454-48607476 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
1117260954 14:54033084-54033106 CAGCCGTATGAGGTGTCAGTCGG + Intergenic
1117511432 14:56455194-56455216 CAGCTGTATGAAGTGTCAGTTGG - Intergenic
1117576662 14:57105872-57105894 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1117796980 14:59405129-59405151 CACCTGTATGAGGTGTCAGTTGG + Intergenic
1118938448 14:70310458-70310480 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1119100727 14:71878063-71878085 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1119147779 14:72332467-72332489 CTGTTCTCTGAGAGGTCAGTTGG - Intronic
1119485205 14:74982337-74982359 GGTTTGTGTGAGGGGTCAGTGGG + Intergenic
1119645136 14:76342410-76342432 GAGTGGTCTGAGGGCTCAGTGGG - Intronic
1120328132 14:83054663-83054685 ATGTTGTATGAGGGATCTGTTGG - Intergenic
1120478856 14:85023736-85023758 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1120619850 14:86750387-86750409 CGCCTGTATGAGGTGTCAGTTGG + Intergenic
1120742873 14:88127612-88127634 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1120940212 14:89940812-89940834 CAAATGTATGAGGATTCAGTGGG + Intronic
1121213952 14:92232822-92232844 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1122443294 14:101749616-101749638 CTCCTGTATGAGGTGTCAGTCGG + Intergenic
1124724614 15:32145310-32145332 CACCTGTATGAGGTGTCTGTTGG + Intronic
1124918102 15:33996433-33996455 CGCCTGTATGAGGTGTCAGTCGG - Intronic
1124935557 15:34166690-34166712 CACCTGTATGAGGTGTCAGTCGG - Intronic
1125352112 15:38778985-38779007 CACCTGTATGAGGTGTCTGTCGG + Intergenic
1125779439 15:42251638-42251660 CAGCTGTATGAAGTGTCAGTTGG + Intronic
1126074452 15:44895927-44895949 CACCTGTATGAGGTGTTAGTTGG + Intergenic
1126086994 15:45020490-45020512 CGCCTGTATGAGGTGTCAGTTGG + Intergenic
1126742144 15:51787604-51787626 CACCTGTATGAGGTGTCTGTCGG - Intronic
1127095822 15:55511558-55511580 CAGCTGAAGGAGGGGTCTGTGGG - Intergenic
1127253806 15:57270959-57270981 CACCTGTATGAGGTGTCTGTTGG + Intronic
1128339780 15:66813395-66813417 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1128782267 15:70368441-70368463 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1129796461 15:78381333-78381355 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1130572228 15:85057192-85057214 CAGCCGTATGAGGTGTCAGTTGG + Intronic
1130703617 15:86211229-86211251 CACCTATATGAGGTGTCAGTTGG + Intronic
1132202094 15:99962117-99962139 CAGCTGTGTGAGGGGTCATGTGG + Intergenic
1133956911 16:10452518-10452540 CTCTTGTATGAGGTGTCTGTTGG + Intronic
1136600499 16:31284110-31284132 CAGCCGTATGAGGTGTAAGTCGG + Intronic
1136890679 16:33969937-33969959 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1137525177 16:49228820-49228842 AGGCTGTATGAGGTGTCAGTTGG - Intergenic
1137680934 16:50344021-50344043 CAGCTGTATGAGGTGTCAGTTGG - Intronic
1138007264 16:53349772-53349794 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1138713157 16:58992638-58992660 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1138782886 16:59810045-59810067 CATCTGTATGGGGTGTCAGTTGG - Intergenic
1141152546 16:81574263-81574285 CAGTTGGAGGAGGGGGCCGTGGG - Intronic
1203082353 16_KI270728v1_random:1153671-1153693 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1143242002 17:5451577-5451599 CAGTTGTCTCAGGGGCCAGCTGG + Intronic
1144294088 17:13856223-13856245 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1145081860 17:19900847-19900869 CAGTGGTATGAGGGGTGGGGTGG + Intergenic
1146298473 17:31670305-31670327 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1146600886 17:34215133-34215155 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1146764560 17:35507488-35507510 CAGCTGAAGGAGGGGTCTGTAGG + Intronic
1147902439 17:43797875-43797897 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1148761148 17:50001270-50001292 CAGCTGGCTGAGGGGCCAGTGGG + Intergenic
1148828568 17:50413549-50413571 CAGCTGAAGGAGGGGTCTGTAGG - Intergenic
1149931998 17:60766587-60766609 CGGCTGTATGAGGTGTCATTCGG + Intronic
1152033564 17:77858283-77858305 TAGTTGGATGAGGGGTGGGTGGG - Intergenic
1152311837 17:79556228-79556250 CTGGTGTTTGAGGGGTCAGCAGG - Intergenic
1152325715 17:79634645-79634667 CCGTTGTCTTAGGGGTGAGTTGG - Intergenic
1153604101 18:6814150-6814172 AAATTCTATGAGGGGTGAGTTGG - Intronic
1154019556 18:10650716-10650738 CTGCCGTATGAGGTGTCAGTCGG - Intergenic
1154364131 18:13690512-13690534 CGTCTGTATGAGGTGTCAGTCGG - Intronic
1154401517 18:14042970-14042992 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1154444923 18:14428302-14428324 CACCTGTATGAGGTGTCTGTCGG + Intergenic
1155476824 18:26243966-26243988 TGGCTGTATGAGGTGTCAGTTGG + Intronic
1155659233 18:28228388-28228410 CACCTGTATGAGTTGTCAGTTGG + Intergenic
1156439262 18:37167438-37167460 CAGTTGGATGGGGTGTCAGAAGG + Intronic
1156443791 18:37219224-37219246 CAGCTGTATGAGGTGTCAGTCGG + Intronic
1157123368 18:44933334-44933356 CAGCCGTATGAGGTGTCAGTCGG + Intronic
1158145663 18:54309480-54309502 CGGCTGTATGAGGTGTCAGTTGG + Intronic
1158292496 18:55957098-55957120 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
1158703758 18:59772077-59772099 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1158858082 18:61564029-61564051 CGGCTATATGAGGTGTCAGTCGG + Intergenic
1159199620 18:65167119-65167141 TGGCTGTATGAGGTGTCAGTAGG - Intergenic
1159570321 18:70104880-70104902 CGGCTGTATGAGGTGTCAGTTGG + Intronic
1160260601 18:77290754-77290776 CAACTCTATGAGGTGTCAGTTGG + Intergenic
1162628554 19:11906433-11906455 CGGCCGTATGAGGTGTCAGTTGG - Intronic
1163691084 19:18738911-18738933 GCCTTGCATGAGGGGTCAGTGGG + Intronic
1163858504 19:19726468-19726490 CGGCTGTATGAGGTGTCAGTTGG + Intronic
1163878469 19:19896936-19896958 CAGCTGAATGAGGGGTCTGCAGG + Intergenic
1163942810 19:20510730-20510752 CAGCTGAAGGAGGGGTCTGTGGG - Intergenic
1164085578 19:21899362-21899384 CATCTGTATGAGGTGTCAGTTGG + Intergenic
1164091397 19:21956219-21956241 CGGCTGTATGAGGTGTCAGTCGG + Intronic
1164236007 19:23335207-23335229 CGGCTGTATGAGATGTCAGTTGG + Intronic
1164394866 19:27853426-27853448 CAGCTGTATGAGGTATCACTTGG - Intergenic
1164495578 19:28757590-28757612 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
1164542801 19:29133332-29133354 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1165003696 19:32787313-32787335 CACCTGTATGAGGTGTCTGTCGG + Intronic
1165973106 19:39649919-39649941 CACCTGTATGAGGTGTCAGTCGG - Intergenic
1166156270 19:40913417-40913439 TGGCTGTATGAGGTGTCAGTGGG - Intergenic
1166163637 19:40970888-40970910 CAGCTGTATGAGGTGTCAATCGG + Intergenic
1166240335 19:41487084-41487106 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1167584112 19:50363634-50363656 CAGTAGTTCGAGGGGGCAGTGGG - Intronic
925172811 2:1760664-1760686 CGGCTGTATGAGGTGTCGGTCGG - Intergenic
925756195 2:7134358-7134380 AAGTGGTAAGGGGGGTCAGTGGG + Intergenic
925929841 2:8698170-8698192 CTGTTGGAGGAGGGGTCAGGTGG + Intergenic
928188186 2:29134636-29134658 CAGTTGTAGGAAGGGTATGTGGG + Intronic
930143211 2:47974249-47974271 CACCTGTATGAGGTGTCTGTTGG - Intergenic
930803105 2:55462889-55462911 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
931594571 2:63927260-63927282 CACCTGTATGAGGTGTCTGTCGG - Intronic
932019135 2:68064500-68064522 CAGCTGTATGAGGTGTCAGTTGG - Intronic
932540023 2:72641815-72641837 CTCCTGTATGAGGTGTCAGTCGG - Intronic
933366663 2:81362354-81362376 CGGCTGTATGAGGTGTCAATCGG + Intergenic
933631375 2:84662862-84662884 CAGCTGTATGAGCTGTCAGTCGG - Intronic
934637297 2:96001747-96001769 CGGCTGTATGAGGTGTCAGTTGG + Intergenic
935604674 2:104959007-104959029 CGCCTGTATGAGGTGTCAGTCGG + Intergenic
935822698 2:106909924-106909946 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
935923715 2:108042984-108043006 CAGTTGTTGGAGGACTCAGTGGG + Intergenic
936019788 2:108986105-108986127 CATTTGTCTCAGGGGCCAGTGGG + Intronic
936142689 2:109953675-109953697 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
936179377 2:110251640-110251662 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
936201999 2:110417792-110417814 TGGCTGTATGAGGTGTCAGTCGG + Intronic
936775286 2:115965410-115965432 CACCTGTAGGAGGTGTCAGTCGG + Intergenic
936806369 2:116337220-116337242 CACCTGTATGAGGTGTCAGTCGG + Intergenic
936823590 2:116553526-116553548 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
936859678 2:117001861-117001883 CGGCTGTATGAGATGTCAGTCGG - Intergenic
936925096 2:117728869-117728891 CAGATGTATGAGATGTGAGTTGG - Intergenic
937074959 2:119096466-119096488 CGGCTATATGAGGTGTCAGTTGG - Intergenic
937606132 2:123803962-123803984 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
939055611 2:137360958-137360980 CAGCTGTATGAGGTATCAGTCGG - Intronic
939730893 2:145783116-145783138 CAGCTGTATGAGATGTCAGTCGG - Intergenic
939974844 2:148705581-148705603 CAGTTGTATGAGGTGTCAGTCGG - Intronic
940644385 2:156375644-156375666 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
940705726 2:157102665-157102687 CAGCTGTATGAGGTGTCAGTAGG + Intergenic
940891565 2:159041174-159041196 CAGCTGTATGAGGTGTCAGTTGG + Intronic
941100239 2:161286910-161286932 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
941896148 2:170630652-170630674 CAGCTGTATGAGGTGTCAGTCGG - Intronic
942753631 2:179315235-179315257 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
942854725 2:180531979-180532001 CAGCTGTATGGGGTGTCAGTCGG + Intergenic
942899730 2:181100198-181100220 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
943299950 2:186186262-186186284 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
943583578 2:189712349-189712371 CGCCTGTATGAGGTGTCAGTCGG - Intronic
943808682 2:192156481-192156503 TTGTTGTATGAGGAGGCAGTAGG - Intronic
943987311 2:194639501-194639523 CGGCTGTATGAGGCGTCAGTCGG - Intergenic
944092341 2:195925786-195925808 CAGTTGACTGAGGGGTCAACTGG - Intronic
944107024 2:196089907-196089929 CGGCTGTATGAGGTATCAGTCGG - Intergenic
944165026 2:196709902-196709924 CGGCTGTATGAGGTGTCAGTTGG + Intronic
944196854 2:197063077-197063099 CAGGCGCATGAGGTGTCAGTCGG - Intronic
944600772 2:201300682-201300704 CAGCTGTATGAGTTGTCAGTTGG - Intronic
944629903 2:201613310-201613332 CAGTTGTATGAGGTGTCAATTGG - Intronic
945677787 2:212876439-212876461 CAGCCATATGAGGTGTCAGTTGG - Intergenic
946205827 2:218107950-218107972 CGGCTGTATGAGGTGTCAATCGG + Intergenic
946229813 2:218284302-218284324 CTGTTGTTAGAGGGGGCAGTGGG - Intronic
946513618 2:220387610-220387632 CAGCTGTATGAGGTGTCAATTGG + Intergenic
946719116 2:222585099-222585121 CGGCTGTATGAGGTGTCAGTCGG - Intronic
946794121 2:223331237-223331259 CACCTGTATGAGGTGTCTGTTGG - Intergenic
947696519 2:232194831-232194853 AGGTTGCATGAGGGGTCACTTGG + Intronic
948025934 2:234776206-234776228 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1169012886 20:2265167-2265189 CACTTATATGAGGTGTCTGTCGG - Intergenic
1170034170 20:11972648-11972670 CAGATGCATGGGGTGTCAGTGGG - Intergenic
1170252086 20:14294987-14295009 AAGTTGGATGATGAGTCAGTGGG - Intronic
1171081898 20:22194853-22194875 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1171443470 20:25186241-25186263 CACCTGTATGAGATGTCAGTTGG + Intergenic
1171454675 20:25261239-25261261 CGGCTGTGTGAGGTGTCAGTCGG - Intronic
1171935188 20:31268441-31268463 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1172456233 20:35076646-35076668 CGGCTGTATGAGGTGTCAGTCGG + Intronic
1173232043 20:41205904-41205926 CAGCTGTATGAGGTGTCAGTCGG - Intronic
1174224017 20:48982395-48982417 CGCCTGTATGAGGTGTCAGTCGG + Intronic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1177111550 21:17034857-17034879 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1180640939 22:17299023-17299045 CGGCTGTATGAGGTGTCAGTTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182197097 22:28529662-28529684 TGGCTGTATGAGGTGTCAGTTGG - Intronic
1184408912 22:44315497-44315519 GAGGTGTATGTGGGCTCAGTAGG - Intergenic
949440218 3:4072018-4072040 CTCTTGTATGAGGTGTCTGTCGG - Intronic
949640365 3:6029719-6029741 CTCTTGTATGAGGTGTCTGTTGG + Intergenic
949816835 3:8068008-8068030 CAGTTGTATGAGGTGTCAGTCGG + Intergenic
950299825 3:11867392-11867414 CAGCTATATGAGGTGTCTGTTGG + Intergenic
950302668 3:11894895-11894917 CAGCTTTATGAGGTGTCAGTTGG - Intergenic
950792579 3:15485281-15485303 CAGCTGTATGAGGTGTCAGTCGG + Intronic
951155678 3:19350485-19350507 CAGCTGCATGAGGTGTCAGTTGG - Intronic
951165666 3:19482784-19482806 CAGCTGAAGGAGGGGTCTGTAGG - Intronic
951368358 3:21812952-21812974 CAGCTGTATGAGGTGTCAGTTGG - Intronic
951389281 3:22082805-22082827 TTGCTGTATGAGGTGTCAGTCGG - Intronic
951471592 3:23062423-23062445 CGCTTGTATGAGGTGTCTGTCGG + Intergenic
951601536 3:24381397-24381419 CAGGACTCTGAGGGGTCAGTAGG + Intronic
951997017 3:28742133-28742155 CAGATGAATGAGAGGTAAGTAGG + Intergenic
952437438 3:33286420-33286442 TGGCTGTATGAGGTGTCAGTCGG + Intronic
952513942 3:34085100-34085122 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
952517634 3:34121982-34122004 CACCTGTATGAGGTGTCAGTTGG + Intergenic
952586991 3:34904862-34904884 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
953337342 3:42104453-42104475 CAGCTGTATGAGGTGTCAGTCGG - Intronic
953374990 3:42421043-42421065 CAGCTGTGTGAGGGGTGAGGAGG - Intergenic
953653057 3:44823403-44823425 CACCTGTATGAGGTGTCAGTCGG + Intronic
954571992 3:51648551-51648573 CGGCTGTATGAGGTGTCAGTCGG - Intronic
955048903 3:55389467-55389489 CAGCTGTATGAGCTGTCAGTCGG - Intergenic
955172558 3:56581797-56581819 CAGCTTTATGAGGTGACAGTCGG + Intronic
955667383 3:61364743-61364765 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
956032513 3:65054448-65054470 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
956268850 3:67428201-67428223 CTGCTGTATGAGGTGTCAGTCGG - Intronic
956477345 3:69636736-69636758 CACCTGTATGAGGTGTCTGTCGG + Intergenic
957406613 3:79780115-79780137 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
957647725 3:82954584-82954606 CAGTTCTATGAAGGCTCAGAGGG - Intergenic
958191695 3:90193012-90193034 CACCTGTATGAGGTGTTAGTCGG + Intergenic
958413909 3:93852174-93852196 CACCTGTATGAGGTGTCAGTTGG + Intergenic
958423094 3:93950441-93950463 TGGCTGTATGAGGTGTCAGTCGG - Intronic
958974003 3:100645181-100645203 CAGTTGTATAAGGTGTTAGGAGG + Intronic
959097353 3:101970798-101970820 CACCTGTATGAGGTGTCTGTTGG + Intergenic
959308207 3:104696371-104696393 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
959692978 3:109219322-109219344 TGCTTGTATGAGGTGTCAGTTGG - Intergenic
959725692 3:109538929-109538951 CGGCCGTATGAGGTGTCAGTTGG - Intergenic
959849995 3:111073658-111073680 CAGTTGAGTGAGAGGACAGTTGG + Intronic
960276739 3:115737883-115737905 CACCTGTATGTGGTGTCAGTCGG + Intergenic
960478862 3:118163358-118163380 CGCCTGTATGAGGTGTCAGTTGG - Intergenic
960655995 3:120004519-120004541 CACCTGTATGAGGTGTCTGTTGG - Intronic
961396042 3:126591390-126591412 CAGCTGTATGAGGTGTTAGTCGG + Intronic
961669423 3:128518034-128518056 CAGTTGAGGGAGGGGGCAGTGGG + Intergenic
961993006 3:131212378-131212400 CGGCTGTATGACGTGTCAGTCGG + Intronic
962180310 3:133199669-133199691 CAGCCGTATGAGGTGTCAGTCGG + Intronic
962291507 3:134140614-134140636 CACCTGTATGAGGTGTCTGTTGG - Intronic
962767026 3:138574695-138574717 TGGCTGTATGAGGTGTCAGTCGG - Intronic
962834093 3:139171856-139171878 CAGGTGTATGAGGTGTCAGTCGG + Intronic
962907564 3:139818621-139818643 CAGCCGTATGAGGTGTCAGTTGG + Intergenic
962980508 3:140485338-140485360 CAGCCGTGTGAGGTGTCAGTCGG + Intronic
963595159 3:147317018-147317040 AGGCTGTATGAGGTGTCAGTCGG + Intergenic
963714351 3:148786023-148786045 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
964214417 3:154263324-154263346 CACCTGTATGAGGTGTCAGTAGG - Intergenic
964924419 3:161938231-161938253 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
965137317 3:164787551-164787573 CAGCCGTGTGAGGTGTCAGTCGG - Intergenic
965200855 3:165655876-165655898 CACCTGTATGAGGTGTCAGTGGG - Intergenic
965393103 3:168129010-168129032 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
965651465 3:170938315-170938337 CGGCCGTATGAGGTGTCAGTTGG + Intergenic
965818888 3:172665373-172665395 TGGCTGTATGAGGTGTCAGTTGG + Intronic
966494179 3:180560662-180560684 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
967248554 3:187513445-187513467 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
967569832 3:191015828-191015850 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
967914764 3:194570594-194570616 CAGTTGTCCTGGGGGTCAGTGGG - Intergenic
970355748 4:15250479-15250501 CATAGGTATGAGTGGTCAGTAGG - Intergenic
970983037 4:22123755-22123777 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
971621266 4:28856895-28856917 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
972429065 4:38963304-38963326 CAGGTGTATGAGAGTTCATTGGG - Intergenic
972431327 4:38985270-38985292 CAGTTAAATGTGGGGTAAGTTGG - Intronic
972685668 4:41350188-41350210 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
972972435 4:44593840-44593862 CAGCTGTGTGAGGTGTCAGTTGG - Intergenic
973569619 4:52224707-52224729 GGGCTGTATGAGGTGTCAGTCGG + Intergenic
973626009 4:52773546-52773568 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
973874789 4:55206648-55206670 CGGTTGTATGAGGTGTCAGTAGG - Intergenic
974023736 4:56713373-56713395 CAGCCGTGTGAGGTGTCAGTTGG - Intergenic
974127579 4:57714845-57714867 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
974176729 4:58334075-58334097 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
974287860 4:59892706-59892728 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
974871807 4:67653279-67653301 CACCTGTATGAGGTGTCTGTCGG - Intronic
975235937 4:71996775-71996797 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
975520936 4:75300374-75300396 CACCTGTATGAGGTGTCAGTTGG + Intergenic
975726857 4:77300875-77300897 CAAATGTGTGAGGTGTCAGTCGG + Intronic
975744580 4:77463990-77464012 CATCTGTATGAGGTGTCAGAAGG + Intergenic
975864896 4:78716091-78716113 CTGGGGTTTGAGGGGTCAGTCGG + Intergenic
976974842 4:91153892-91153914 CGGCTGTATGAGGTGTCAGTCGG + Intronic
977043163 4:92039295-92039317 CAGCTGAAGGAGGGGTCTGTAGG - Intergenic
977194781 4:94045202-94045224 CACCTGTATGAGGTGTCAGTCGG - Intergenic
977288590 4:95139297-95139319 TGGCTGTATGAGGTGTCAGTCGG + Intronic
977630638 4:99239000-99239022 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
977633538 4:99269993-99270015 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
977972782 4:103230584-103230606 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
978110690 4:104961196-104961218 TGGCTGTATGAGGGGTCAGTTGG + Intergenic
978148787 4:105409643-105409665 CACCTGTATGAGGTGTCTGTCGG - Intronic
978236837 4:106470972-106470994 CTCTTGTATGAGGTGTCTGTTGG + Intergenic
978340144 4:107714029-107714051 CAGTTGAAAGAGGGTTCAGAAGG - Intronic
979017409 4:115452104-115452126 CATCTGTATGAGGTGTCTGTTGG + Intergenic
979750631 4:124274779-124274801 CAGCTGTATGAAGTGTCATTCGG + Intergenic
979934121 4:126670466-126670488 CAGCTGTATGAGGTGTCATTCGG - Intergenic
980073405 4:128266819-128266841 CAGCTGAAGGAGGGGTCTGTAGG + Intergenic
980196052 4:129590415-129590437 TAGCTGTATGAGGTGTCGGTTGG + Intergenic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
980558672 4:134442538-134442560 CACCTGTATGAGGTGTCTGTCGG + Intergenic
980848818 4:138355492-138355514 CAGCCGTATGAGGTGTCACTTGG - Intergenic
981208012 4:142067081-142067103 CAGCTGTATGAGGTGTCAGTGGG - Intronic
981445874 4:144837451-144837473 CACCTGTATGAGGTGTCAGTCGG - Intergenic
981501661 4:145458267-145458289 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
981514843 4:145596689-145596711 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
981869470 4:149468733-149468755 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
982579774 4:157162718-157162740 CGGCTGTATGAGGTGTCAGTTGG + Intronic
983228743 4:165109124-165109146 CAGATGTAAGAGAGTTCAGTAGG - Intronic
983879125 4:172912973-172912995 CGGCTGTATGAGGTGTCAGTCGG - Intronic
985171361 4:187153602-187153624 ATGTGGTATGAGGGGTCAGGTGG + Intergenic
985473722 5:65516-65538 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
986149550 5:5115059-5115081 CACCTGTATGAGGTGTCTGTTGG + Intergenic
986353580 5:6903178-6903200 CAGATGTGTCAGGGGTCAGTTGG + Intergenic
986653932 5:9991478-9991500 CGGCCGTATGAGGTGTCAGTTGG - Intergenic
987315166 5:16717251-16717273 CAGTTTTATAATGTGTCAGTAGG - Intronic
987494746 5:18629654-18629676 GTGTTGTATGAGGGGCCAGGTGG - Intergenic
987611590 5:20211500-20211522 CGGCTGAATGAGGTGTCAGTTGG - Intronic
988023613 5:25655236-25655258 TGGCTGTATGAGGGGTTAGTCGG + Intergenic
988187783 5:27889283-27889305 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
988309678 5:29541567-29541589 CACCTGTATGAGGTGTCTGTCGG + Intergenic
988381230 5:30499238-30499260 CACCTGTATGAGGTGTCTGTCGG + Intergenic
988668198 5:33353546-33353568 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
988840209 5:35075796-35075818 TGGGTGTATGAGGTGTCAGTCGG - Intronic
989337586 5:40336638-40336660 CACCTGTATGAGGTGTCTGTTGG - Intergenic
989345234 5:40422601-40422623 CACCTGTATGAGGTGTCAGTTGG + Intergenic
989418302 5:41205976-41205998 CAGCTGTATGAGGTGTCAGTCGG - Intronic
989562072 5:42863563-42863585 CAGCTGTATGAGGTGTCAGTCGG - Intronic
989583333 5:43053861-43053883 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
989608157 5:43266007-43266029 CAGCTGTGTGAGGCATCAGTCGG + Intronic
989623050 5:43403269-43403291 CGGCTGTATGAGGTGTCAGTCGG - Intronic
989768719 5:45117204-45117226 TAGCTGTATGAAGTGTCAGTCGG + Intergenic
990164065 5:52975996-52976018 CAGCTGTATGAGGTTTCAGTCGG + Intergenic
990244821 5:53854087-53854109 CAGCTGTATGAGGTATCAGTTGG + Intergenic
990541900 5:56781706-56781728 AGGCTGTATGAGGTGTCAGTCGG + Intergenic
990750509 5:59010899-59010921 TGGCTGTATGAGGTGTCAGTTGG - Intronic
991675773 5:69088666-69088688 CAGCTGAAGGAGGGGTCTGTAGG - Intergenic
992274610 5:75102315-75102337 CAGCAGTATGAGGTGTCAGTTGG + Intronic
992564787 5:77986467-77986489 TTGTTCTTTGAGGGGTCAGTGGG - Intergenic
992973193 5:82083589-82083611 CAGTTGTATGAGGGGTCAGTTGG - Intronic
993497371 5:88622860-88622882 CACCTGTATGAGGTGTCAGTCGG + Intergenic
993546673 5:89220634-89220656 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
993627092 5:90239003-90239025 CAGTTGTATGAGGTGTCAGTCGG - Intergenic
993888347 5:93442799-93442821 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
994528462 5:100935471-100935493 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
994861244 5:105198619-105198641 CGGCTGTATGAGGTGTCATTCGG - Intergenic
995233055 5:109792784-109792806 CTGTTGGCTGAGGGTTCAGTTGG + Intronic
995270678 5:110216891-110216913 CAGCCGTTTGAGGTGTCAGTCGG + Intergenic
995459815 5:112390800-112390822 CAGCTGTATGAGGTGTCAGTTGG - Intronic
995474231 5:112531770-112531792 CAGTTGAAGGAGGGGTCTGTGGG + Intergenic
995528998 5:113074138-113074160 CAGCTGTATGAGGTGTCAGTCGG - Intronic
995749902 5:115442636-115442658 CAGCAGTATGAGGTATCAGTTGG - Intergenic
996275448 5:121660630-121660652 CTGCTGTATGAGGTGTCTGTTGG - Intergenic
996639942 5:125740253-125740275 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
996936559 5:128956128-128956150 AAGGTGTATGAGGGGAGAGTGGG - Intronic
996937114 5:128962097-128962119 CGGCTGGATGAGGTGTCAGTCGG + Intronic
999046553 5:148475833-148475855 CAGTGTGATGAGGCGTCAGTGGG - Intronic
999542335 5:152587098-152587120 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1000595746 5:163212711-163212733 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1000746962 5:165045828-165045850 CGGCTGTATGAGGTGTCAGTAGG + Intergenic
1001009177 5:168082835-168082857 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1001076442 5:168631444-168631466 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
1001446644 5:171790388-171790410 CAGTGTGATGAAGGGTCAGTGGG - Intronic
1003496623 6:6668888-6668910 CACCTGTATGAGGTGTCTGTAGG - Intergenic
1003542214 6:7027588-7027610 CACCTGTATGAAGTGTCAGTTGG - Intergenic
1004056113 6:12140090-12140112 CGCCTGTATGAGGTGTCAGTCGG - Intronic
1004731009 6:18359160-18359182 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1005505644 6:26467019-26467041 CTGTTGCCTGAGGGGTCTGTGGG - Intronic
1006803175 6:36772136-36772158 CAGGGTTGTGAGGGGTCAGTTGG + Intronic
1007134650 6:39508977-39508999 CACCTGTATGAGGTGTCTGTCGG - Intronic
1007412479 6:41673089-41673111 CAGATGGAAGAGGGGACAGTGGG - Intergenic
1007988318 6:46230160-46230182 TGGCTGTATGAGGTGTCAGTTGG + Intronic
1008123179 6:47641021-47641043 CGGCTGTGTGAGGTGTCAGTCGG + Intergenic
1008140044 6:47821760-47821782 CGGATGTATGAGGTGTGAGTGGG - Intronic
1008436801 6:51485783-51485805 CAGTTGTATGAGGTGTCAGTTGG + Intergenic
1008529957 6:52447954-52447976 TGGCTGTATGAGGTGTCAGTTGG + Intronic
1008633227 6:53383457-53383479 CAGCTGTGTGAAGTGTCAGTCGG - Intergenic
1009457892 6:63878359-63878381 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1009628726 6:66167226-66167248 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1009679643 6:66875168-66875190 CAACTGTATGAGGTGTCTGTTGG + Intergenic
1010171759 6:72984101-72984123 GGGCTGTATGAGGTGTCAGTCGG + Intronic
1010282180 6:74035091-74035113 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1010670122 6:78676691-78676713 CAGTTGTTTGAGGTGTCAGTCGG - Intergenic
1010682989 6:78818266-78818288 CAGCTCCATGAGGTGTCAGTCGG - Intergenic
1010688386 6:78878251-78878273 GAGACGTATGAGGTGTCAGTTGG - Intronic
1010727084 6:79347486-79347508 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1010755621 6:79663558-79663580 CGCCTGTATGAGGTGTCAGTCGG + Intronic
1011139063 6:84133243-84133265 CGGCTGTATGAGGTGTCAGTTGG + Intronic
1011234664 6:85202738-85202760 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1011288665 6:85752383-85752405 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1011298216 6:85846826-85846848 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1011304147 6:85908418-85908440 CACATGTACGAGGTGTCAGTCGG + Intergenic
1011417807 6:87140412-87140434 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1011537445 6:88391444-88391466 CACCTCTATGAGGGGTCTGTTGG - Intergenic
1011784686 6:90830604-90830626 CAGTTGTAGAAGGGGTCAGCAGG + Intergenic
1012129443 6:95472152-95472174 CAGCCGTATGAGGTGTTAGTTGG - Intergenic
1012725803 6:102808828-102808850 CACTTGTATGAGGTGTCAGTCGG + Intergenic
1012799104 6:103802580-103802602 CTGCTGTATGAGTTGTCAGTTGG - Intergenic
1012941063 6:105415736-105415758 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1013169207 6:107620882-107620904 CAGTTGTATGAAGGGTCAGATGG + Intronic
1013258302 6:108411514-108411536 CAGCTGTATGAGGTGTCAGTCGG - Intronic
1013517880 6:110905040-110905062 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
1013578256 6:111507115-111507137 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1014907171 6:127043975-127043997 CACCTGTATGAGGTGTCAGCCGG - Intergenic
1015247137 6:131087074-131087096 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
1015430270 6:133123040-133123062 CAGCAGTATGAGGTGTCAGTTGG + Intergenic
1015893181 6:137989539-137989561 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1015967650 6:138711316-138711338 CACTTATATGAGGTGTCTGTCGG + Intergenic
1016102119 6:140115451-140115473 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1016875802 6:148863886-148863908 CGGCCGTATGAGGTGTCAGTTGG + Intronic
1017659984 6:156664232-156664254 CACCTCTATGAGGTGTCAGTCGG - Intergenic
1017713318 6:157189664-157189686 CAGTTGACTGGGGGGTCTGTGGG - Exonic
1018114029 6:160565281-160565303 CAGCTGTATGAGGTGTCAGTTGG - Intronic
1018760028 6:166885567-166885589 CTGCTGTATGAGGTGTCAGTCGG - Intronic
1020349353 7:7201386-7201408 CAGCTGTATGAGGTGCCAGTCGG + Intronic
1020774086 7:12431741-12431763 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1021201792 7:17735441-17735463 CAGCTCTATGAGGTGTCTGTTGG - Intergenic
1021798122 7:24278380-24278402 CGGCTGTATGAGTTGTCAGTTGG + Intergenic
1022187341 7:27982709-27982731 GAGGTGTATGAGGTGTCACTTGG - Intronic
1022453646 7:30538224-30538246 CGGCTGCATGAGGTGTCAGTTGG - Intronic
1022867050 7:34432055-34432077 CACCTGTATGAGGTGTCAGTTGG - Intergenic
1024130018 7:46341714-46341736 CACCTGTATGAGGTGTCTGTCGG + Intergenic
1024481197 7:49865195-49865217 CAGTTGTTTGTGTGGTCCGTGGG + Intronic
1024643011 7:51346863-51346885 CAGTTGGAAAAGGGGTCAGGAGG + Intergenic
1024738175 7:52328199-52328221 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1024817435 7:53287739-53287761 CGGCTGTATGAGGGGTCAATCGG + Intergenic
1025034159 7:55582577-55582599 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1027493603 7:78860627-78860649 CGGCTGTATGAGGTGTCATTCGG + Intronic
1027574563 7:79915800-79915822 CGCCTGTATGAGGTGTCAGTTGG - Intergenic
1027835723 7:83238977-83238999 CTGTTGTGTGAGGGGTCCGGTGG - Intergenic
1028004282 7:85542559-85542581 TAGCTGTACGAGGTGTCAGTTGG + Intergenic
1028013538 7:85679228-85679250 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
1028022264 7:85791640-85791662 CAGCTGTATGAGGTGTCAGCCGG - Intergenic
1028050117 7:86174672-86174694 CGGCTGTATGAGGTGTCAGTCGG - Intergenic
1028078686 7:86547672-86547694 AGGCTGTATGAGGTGTCAGTCGG + Intergenic
1028114546 7:86982413-86982435 CACCTATATGAGGTGTCAGTCGG - Intronic
1028167658 7:87556864-87556886 CAGTTGAATGAGGGGAGATTGGG - Intronic
1028369108 7:90070688-90070710 CGGCTGTATGAAGTGTCAGTTGG - Intergenic
1028446379 7:90928605-90928627 TGGCTGTATGAGGTGTCAGTTGG + Intronic
1028526381 7:91791202-91791224 CACCTGTATGAGTTGTCAGTCGG - Intronic
1028578536 7:92380486-92380508 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1028607710 7:92673184-92673206 CAGTTATATGGGAGGTCAGTTGG - Intronic
1029057451 7:97761156-97761178 CGGTCGTATGAGGTGTCAGTTGG - Intergenic
1029062332 7:97811066-97811088 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1029951610 7:104592489-104592511 CAGCTGTATGAGGTGTCAGTCGG + Intronic
1030177793 7:106672486-106672508 TATCTGTATGAGGTGTCAGTTGG - Intergenic
1030181128 7:106710134-106710156 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
1030220968 7:107098899-107098921 CAGCTGTATGAGGTGTCAGTTGG + Intronic
1030266865 7:107630111-107630133 CAGTTGTATGATAGGTTGGTAGG + Intergenic
1030526427 7:110660500-110660522 CAGCTGTTTGAGGTGTCAGTCGG + Intergenic
1031659021 7:124397430-124397452 CAGTGGTCTGAGCGGTCAGAAGG + Intergenic
1031699104 7:124901256-124901278 CAGCTGTGTGAGGTGTCAGTTGG - Intronic
1032019733 7:128400649-128400671 CAGTGGGATGAGGAGCCAGTGGG + Intronic
1032247359 7:130224218-130224240 CAGGAGTCTGTGGGGTCAGTCGG + Intergenic
1032450123 7:132023538-132023560 CAGTTGTCTGTGGGATCAATAGG + Intergenic
1032686559 7:134239808-134239830 CGGCTGTATGAGGTGTCAGTTGG - Intronic
1033293399 7:140108653-140108675 CAGCTGTATGAGGTGTCAGTCGG + Intronic
1033863451 7:145659303-145659325 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1033887592 7:145967308-145967330 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1033902320 7:146157993-146158015 CGGCTGTATGAGGTGTCAGTTGG - Intronic
1034208906 7:149345220-149345242 CAGCTGTATGAGATGTCAGTTGG + Intergenic
1037033362 8:14136903-14136925 CTGCTGTATGAGGTGTCAGTCGG - Intronic
1037249863 8:16879027-16879049 CGGCTGTATGAGGTGTCATTCGG - Intergenic
1037545378 8:19915383-19915405 CAGCTATATGAGGTGTCAGTTGG + Intronic
1037557584 8:20040708-20040730 CAGGTGTATGAGATGTCAGTTGG + Intergenic
1038221676 8:25614741-25614763 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1040071039 8:43189016-43189038 CAGCTGTATGGGGTGTCAGTCGG + Intronic
1040383416 8:46894691-46894713 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1040556755 8:48486290-48486312 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1040712814 8:50209479-50209501 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1041275317 8:56151544-56151566 CAGCCGTATGAGGTGTCAGTTGG + Intergenic
1041665859 8:60444369-60444391 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1041772043 8:61481956-61481978 TAGCTGTATGAGGTGTCAGTCGG - Intronic
1042638540 8:70906011-70906033 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1042833523 8:73056507-73056529 CGCCTGTATGAGGTGTCAGTAGG - Intergenic
1043279486 8:78445597-78445619 CAGCTATATGAGGTGTCAGTTGG - Intergenic
1043605080 8:81990493-81990515 TGGCTGTATGAGGTGTCAGTGGG + Intergenic
1044007955 8:86960742-86960764 CAGCTGTATGAGGTGTCACTTGG - Intronic
1044254633 8:90045791-90045813 TGGCTGTATGAGGTGTCAGTTGG - Intronic
1044576908 8:93779766-93779788 CACCTGTATGAGGTGTCTGTCGG + Intronic
1044798907 8:95933304-95933326 CGCGTGTATGAGGTGTCAGTCGG + Intergenic
1044809012 8:96038505-96038527 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1044956557 8:97487543-97487565 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1046601976 8:116327231-116327253 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1047698475 8:127427144-127427166 CAGTTGTATATGTCGTCAGTAGG + Intergenic
1048293565 8:133198363-133198385 CAGTTGTATGAGGCTGCTGTGGG - Intronic
1049484895 8:142850680-142850702 CAGCTGTATGAGGTGTCAGTTGG - Intronic
1049719068 8:144107280-144107302 CAGGAGTCTGAGGGGTGAGTGGG - Exonic
1050215040 9:3313123-3313145 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1050387057 9:5101629-5101651 CACCTGTATGAGGTGTCAGTTGG - Intronic
1050422141 9:5477211-5477233 CGGCTGTATGAGGTGTCAGTCGG + Intergenic
1051215027 9:14788323-14788345 CAGTTGTATAAGTGGTGAATGGG - Intronic
1052063826 9:23992424-23992446 CACCTGTATGAGGTGTCTGTAGG - Intergenic
1052770552 9:32684865-32684887 CGGCTGTATGAGGTGTCAGTTGG - Intergenic
1052887793 9:33666754-33666776 CAGCTGAATGAGGTGTCAGTTGG - Intergenic
1053041706 9:34878966-34878988 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1053583027 9:39426373-39426395 AGGCTGTATGAGGTGTCAGTCGG - Intergenic
1053751672 9:41263396-41263418 CATCTGTATGAGGTGTCTGTTGG + Intergenic
1053847210 9:42251234-42251256 AGGCTGTATGAGGTGTCAGTCGG - Intergenic
1054104606 9:60985116-60985138 AGGCTGTATGAGGTGTCAGTCGG - Intergenic
1054334118 9:63788000-63788022 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1054581735 9:66921733-66921755 AGGCTGTATGAGGTGTCAGTCGG + Intronic
1054887202 9:70212010-70212032 CAGCTGTATTAAGTGTCAGTTGG + Intronic
1054997407 9:71407830-71407852 CGGCTGTATGAGGTGTCAGTTGG - Intronic
1055014008 9:71596262-71596284 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1055563417 9:77544400-77544422 CATTTGTAAGAAGGGTCAGTAGG + Intronic
1056426279 9:86480585-86480607 CAGCTATATGAGGTGTCAGTCGG + Intergenic
1056700946 9:88907681-88907703 CAGCTGTATGAGATGTCAGTAGG - Intergenic
1056727045 9:89128507-89128529 GAGCTGTATGAGGTGTCAGTCGG - Intronic
1057120951 9:92573482-92573504 GGGCTGTATGAGGTGTCAGTCGG + Intronic
1057175875 9:92998855-92998877 CGGCTGTATGGGGTGTCAGTCGG + Intronic
1057698084 9:97341571-97341593 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1057769029 9:97950769-97950791 CGCCTGTATGAGGTGTCAGTCGG + Intergenic
1058012057 9:99989286-99989308 CAGCTGTATGAGGTGTCAGTCGG - Intronic
1058036470 9:100258800-100258822 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1058085966 9:100748856-100748878 TGGCTGTATGAGGTGTCAGTTGG + Intergenic
1058614379 9:106809911-106809933 CACCTGTGTGAGGTGTCAGTTGG - Intergenic
1059509022 9:114826719-114826741 CAGCTGTGTGAAGGGTGAGTTGG + Intergenic
1060371983 9:123082417-123082439 CAGTTGTATGAAAGGGCTGTGGG - Intronic
1061552335 9:131344780-131344802 CGGCTGTACGAGGTGTCAGTCGG + Intergenic
1061783568 9:133009716-133009738 CAGATGGATGAGGGGCAAGTGGG + Intergenic
1062126346 9:134864989-134865011 CAGCTGTGTGAGGAGGCAGTGGG + Intergenic
1203492042 Un_GL000224v1:116382-116404 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1203504666 Un_KI270741v1:58254-58276 CACCTGTATGAGGTGTCTGTTGG + Intergenic
1185806283 X:3060041-3060063 CACCTGTATGAGTTGTCAGTTGG - Intronic
1186563621 X:10638764-10638786 CAGCTGTATGAGGTGTCAGTTGG - Intronic
1186601452 X:11042010-11042032 TAGGGATATGAGGGGTCAGTGGG - Intergenic
1188108966 X:26175203-26175225 CGGCTGTATGAAGTGTCAGTCGG - Intergenic
1188119465 X:26286717-26286739 CACCCGTATGAGGTGTCAGTCGG + Intergenic
1188271991 X:28152106-28152128 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1189384703 X:40527881-40527903 CAGTTGTTTTAGGGGCCAGCTGG + Intergenic
1189930427 X:46003721-46003743 CGGCCGTATGAGGTGTCAGTTGG + Intergenic
1190151686 X:47955132-47955154 CATTTGTAGAAGGGGTCAGGTGG + Intronic
1190161008 X:48031303-48031325 CATTTGTAGAAGGGGTCAGGTGG - Intronic
1190209623 X:48434192-48434214 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
1190270685 X:48860918-48860940 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
1190517826 X:51243252-51243274 CAGTTGTAGGCAGGGTGAGTTGG + Intergenic
1190683364 X:52848944-52848966 CATCTGTATGAGATGTCAGTTGG + Intergenic
1190840865 X:54142847-54142869 CGGCTGTATGAGGTGTCGGTCGG - Intronic
1190951927 X:55154338-55154360 CATTTGTATGAGGATTCAGGAGG - Intronic
1190979569 X:55443953-55443975 CAGCTGTATGAGGTGTCAGTCGG - Intergenic
1191204019 X:57815831-57815853 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1191643292 X:63451742-63451764 CGGCTGTATGAGGTGCCAGTAGG + Intergenic
1191775564 X:64809125-64809147 TAGCTGTATGAGGTGTCAGTTGG - Intergenic
1191809444 X:65171424-65171446 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1191882367 X:65856056-65856078 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1191886499 X:65894051-65894073 CACCTGTATGAGGTGTCTGTCGG + Intergenic
1192066315 X:67889342-67889364 CAGCTGTACGAGGTGTCAGTCGG + Intergenic
1192097270 X:68225480-68225502 CAGCTGTATGAGTTGTCAGTTGG - Intronic
1192287629 X:69755446-69755468 TGGCTGTATGAGGTGTCAGTCGG + Intronic
1192678899 X:73230573-73230595 CGCCTGTATGAGGTGTCAGTTGG - Intergenic
1192857229 X:75025199-75025221 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1193167157 X:78294370-78294392 CACCTGTATGAGGTGTCTGTCGG + Intronic
1193316000 X:80065955-80065977 CAGCTGTATGAGGTGTCAGTCGG + Intergenic
1193338636 X:80320010-80320032 CAGCTGTATAAGGTGTCAGTCGG - Intergenic
1193343706 X:80382368-80382390 CGGTTGTATGAGGTGTCAGTCGG + Intronic
1193419848 X:81270619-81270641 CACCTGTATGAGGTGTCTGTTGG + Intronic
1193477296 X:81982203-81982225 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1193595023 X:83435413-83435435 CTCCTGTATGAGGGGTCTGTTGG + Intergenic
1193733790 X:85133048-85133070 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1194384788 X:93238774-93238796 CAGCTGAAGGAGGGGTCTGTGGG + Intergenic
1194726983 X:97410121-97410143 CGCCTGTATGAGGTGTCAGTAGG - Intronic
1194761693 X:97803297-97803319 TGGCTGTATGAGGTGTCAGTCGG + Intergenic
1195098083 X:101525050-101525072 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1195163628 X:102196442-102196464 CGGCTGTATAAGGTGTCAGTTGG + Intergenic
1195603091 X:106771138-106771160 CCACTGTATGAGGTGTCAGTCGG + Intronic
1195856148 X:109335203-109335225 CAGCAGTGTGAGGTGTCAGTCGG + Intergenic
1196230139 X:113211924-113211946 TGTCTGTATGAGGGGTCAGTCGG + Intergenic
1196459664 X:115917293-115917315 CAGCTGAAGGAGGGGTCTGTGGG - Intergenic
1197478054 X:126947512-126947534 CAGCTTTATGAGGTGTCAGTCGG - Intergenic
1197959680 X:131990205-131990227 CACCTGTATGAGGTGTCTGTCGG - Intergenic
1198168431 X:134080206-134080228 CAGCTGTATGAGGTGTCAGTTGG - Intergenic
1198335746 X:135664925-135664947 CGGCTGTTTGAGGTGTCAGTCGG + Intergenic
1198366046 X:135941149-135941171 CAGTTGTATGAGGTGTCAGTCGG + Intergenic
1198571352 X:137960408-137960430 CGGCTGTATGAGATGTCAGTTGG - Intergenic
1198581875 X:138074141-138074163 TGGCTGTATGAGGTGTCAGTCGG - Intergenic
1198584571 X:138106013-138106035 TGGCTGTATGAGGTGTCAGTTGG - Intergenic
1198592472 X:138199028-138199050 CAGCCATATGAGGTGTCAGTCGG - Intergenic
1198820661 X:140644748-140644770 CATATGTATGATGGGGCAGTGGG + Intergenic
1198858580 X:141045038-141045060 CAGCCGTATGAGGTGTCAGTTGG - Intergenic
1198895377 X:141448618-141448640 CGGCTGTATAAGGTGTCAGTTGG - Intergenic
1198904117 X:141542350-141542372 CAGCCGTATGAGGTGTCAGTTGG + Intergenic
1199383835 X:147201025-147201047 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1199449965 X:147968152-147968174 CAGCTGTATGAGATGTCAGTCGG - Intergenic
1199796265 X:151200554-151200576 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1199914576 X:152325454-152325476 TGGCTGTATGAGGTGTCAGTCGG - Intronic
1200650306 Y:5832988-5833010 CGCTTGTATGAGTTGTCAGTCGG - Intergenic
1201314385 Y:12629488-12629510 CACCTGTATGAGGTGTCAGTAGG + Intergenic
1201459547 Y:14206920-14206942 CACCTGTATGAGGTGTCTGTTGG - Intergenic
1201992390 Y:20042241-20042263 CAGCTGTATGAGGTGTCAGTTGG + Intergenic
1202054889 Y:20819209-20819231 CACCTGTATGAGGTGTCAGCTGG - Intergenic
1202253903 Y:22901385-22901407 CAGTTGTGTGAGGTGTCAGGTGG + Intergenic
1202406893 Y:24535134-24535156 CAGTTGTGTGAGGTGTCAGGTGG + Intergenic
1202463888 Y:25134947-25134969 CAGTTGTGTGAGGTGTCAGGTGG - Intergenic