ID: 992979792

View in Genome Browser
Species Human (GRCh38)
Location 5:82157035-82157057
Sequence CAGCACATCTGGCAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992979792 Original CRISPR CAGCACATCTGGCAGTTTTC TGG (reversed) Intronic
903504599 1:23824617-23824639 TAACACATCTGGCAGTGTTCTGG - Intronic
907551623 1:55309806-55309828 CAGCAGATCTGAGTGTTTTCTGG + Intergenic
908462336 1:64357530-64357552 CAGCACCTCTGCCAGCTTCCAGG - Intergenic
909252227 1:73373134-73373156 CAACAAAACTGCCAGTTTTCAGG - Intergenic
911072123 1:93840398-93840420 CATCACACCAGGCACTTTTCTGG - Intronic
912775719 1:112505202-112505224 CAGGTAATCTGGCAGCTTTCAGG + Intronic
913113811 1:115679068-115679090 CAGCATACCTGGCAGTATTAGGG - Intronic
915171974 1:153984579-153984601 GAGCACTTCTGGCATTTCTCCGG - Intronic
916610101 1:166383476-166383498 CACCACAGCTGTCAGTTTGCAGG + Intergenic
918047174 1:180948597-180948619 CAGCACATCAGACACTTCTCTGG + Exonic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918656643 1:187035082-187035104 AAACTCAACTGGCAGTTTTCAGG - Intergenic
919397297 1:197067842-197067864 CAGCACATGTAACAGTTTTGAGG + Intergenic
920011000 1:202867619-202867641 CACCACACCTGGCCTTTTTCAGG + Intergenic
921481060 1:215665110-215665132 CAGTACCTCTGGCAGTCTTCAGG + Intronic
923380369 1:233411348-233411370 TACCATATCAGGCAGTTTTCTGG + Intergenic
1063151852 10:3344321-3344343 CAGCACATGTGGCTGTTACCCGG + Intergenic
1064150731 10:12862113-12862135 TAGCAACTCTGGCAGTATTCTGG - Intergenic
1067202245 10:44183318-44183340 CAGTACATCTTGGACTTTTCAGG - Intergenic
1068908720 10:62355971-62355993 CATCACATATGGCATTTTTTTGG - Intergenic
1070335479 10:75451400-75451422 CAGCAAAGCTGGCATTTGTCGGG - Intronic
1070549956 10:77483294-77483316 AAGGACATCCGGCAGTTTTCTGG + Intronic
1071049126 10:81424416-81424438 CAGCTCATCTGGCTCTTGTCTGG + Intergenic
1072759209 10:98042069-98042091 CACCACATCTGGCAAATTTTTGG + Intergenic
1075540140 10:123305781-123305803 AAGCACATCTGGAAGTTCTTTGG - Intergenic
1075975000 10:126687154-126687176 CAGCCCCTCTGGCAGCTGTCTGG + Intergenic
1079395561 11:20060072-20060094 GAGCACATCTGGCAGGCTTAAGG - Intronic
1080087010 11:28295372-28295394 CAGCACCTCTTTCAGCTTTCAGG - Intronic
1080973622 11:37308269-37308291 CATCACACTTGGCATTTTTCTGG + Intergenic
1084593864 11:70105676-70105698 CACCAGAGCTGGCAGTTCTCTGG - Intronic
1086754668 11:90544907-90544929 ATGCACATTTGGGAGTTTTCAGG - Intergenic
1088720300 11:112586379-112586401 AATCACATCTTGCAGTTTTCGGG + Intergenic
1089063572 11:115645587-115645609 CAGCACATCTATCCGTCTTCCGG - Intergenic
1089238426 11:117052931-117052953 CAGCACATCTGATTGTTTACTGG + Intronic
1089821506 11:121231544-121231566 GAGCAAATCAGGCAGTTGTCAGG - Intergenic
1092279800 12:7090496-7090518 CTGCTCCTCTGGCAGGTTTCAGG + Intronic
1092403520 12:8198243-8198265 CACCACAGCTGGCAGTCTTTTGG - Intergenic
1093875770 12:24347898-24347920 AAGCATCTCTGGAAGTTTTCTGG - Intergenic
1102729584 12:115096530-115096552 CATCACATCTTGCAGCCTTCAGG - Intergenic
1102912116 12:116724425-116724447 CACCACACCCGGCAGGTTTCAGG - Intronic
1103189007 12:118984450-118984472 CAGCACATGTAGCAGTCTGCAGG + Intronic
1104831788 12:131757420-131757442 CAGCACATCTGACAGGCTTTAGG + Intronic
1105872654 13:24519851-24519873 CAGCACATCAGGTAGGTTTTTGG + Intergenic
1108478124 13:50841574-50841596 CACCACATCTGGCTGATTTCAGG - Intronic
1112504368 13:99967235-99967257 TAGCACATCTGAGAGTATTCAGG + Intronic
1114149487 14:20021196-20021218 AAGAAAATCTGGTAGTTTTCTGG - Intergenic
1118611125 14:67541032-67541054 CAAAATATCTAGCAGTTTTCTGG + Intronic
1118753522 14:68822747-68822769 CAGCTCATCTGGGAGTTCCCTGG - Intergenic
1123625829 15:22226384-22226406 CAGGACTTCTTGCATTTTTCAGG - Intergenic
1126811138 15:52405482-52405504 CACAACATCTGGCAATATTCAGG - Intronic
1127465845 15:59243944-59243966 AAGCACATCTGGGAGGTTCCAGG + Intronic
1127706093 15:61548536-61548558 CAGGACATCTGCCAGTGTTCTGG - Intergenic
1128534144 15:68478076-68478098 CTGCATGTCTTGCAGTTTTCTGG + Intergenic
1135302663 16:21344511-21344533 CAACATATCTGGCAGTCGTCAGG - Intergenic
1136299423 16:29323727-29323749 CAACATATCTGGCAGTCGTCAGG - Intergenic
1136341533 16:29647075-29647097 CACCACACCTGGCAGTTTTCTGG + Intergenic
1136382728 16:29903688-29903710 CAGCACATGTGGCATCTGTCAGG - Intronic
1138755930 16:59485286-59485308 CAGCACATCAGCAAGTTTGCAGG - Intergenic
1140141507 16:72262486-72262508 CAGCAATTCTGGCTGTTTTGTGG + Intergenic
1140782636 16:78310642-78310664 CAGCACATTTGGCATCTCTCTGG + Intronic
1141589900 16:85061536-85061558 CAGCACATTTGGGAGTTCTTGGG + Intronic
1141881775 16:86865038-86865060 CAGCACACCGGGCACTGTTCTGG + Intergenic
1142061167 16:88030554-88030576 CAACATATCTGGCAGTCGTCAGG - Intronic
1146375900 17:32294230-32294252 CAGCACAACAGGAAGTTTCCTGG + Intronic
1146424400 17:32722905-32722927 CAGCACATGACGGAGTTTTCTGG - Intronic
1146438619 17:32874559-32874581 CAGCACATCTTGTAGTTCTTTGG + Intronic
1148649326 17:49238422-49238444 CAGCAGATCTGCCAGTTGTTTGG - Intergenic
1149973055 17:61238204-61238226 CACCACACCTGGCAGTTTTTCGG + Intronic
1150037136 17:61815091-61815113 CAGCACTTCTAGCATTTTTCAGG - Intronic
1150831044 17:68519419-68519441 CATGACATCTGACAGTTTTGAGG - Intronic
1151915508 17:77115007-77115029 CAGCAGGACGGGCAGTTTTCTGG - Intronic
1151970471 17:77454973-77454995 CATCACCTCTGCCACTTTTCAGG - Intronic
1153586933 18:6631644-6631666 CAACAAATCTGGAAATTTTCTGG + Intergenic
1156141623 18:34119323-34119345 GTGCAAATCTGGCAGTTTCCTGG - Intronic
1156672732 18:39490447-39490469 CAGCACATCTGACAGTAATAAGG + Intergenic
1158907525 18:62028171-62028193 AAGAACAGCTGACAGTTTTCAGG + Intergenic
1160877245 19:1302442-1302464 CGGCACATCTGTAAGTTCTCGGG + Intergenic
1161258733 19:3323792-3323814 CAGCTCATCTTGTAGTTCTCAGG + Intergenic
1163701161 19:18787322-18787344 CAGCCCAGCTTGCATTTTTCTGG + Intronic
1167195403 19:48024701-48024723 CAGCAGAACTGGCACTTTGCAGG + Intronic
925599270 2:5591162-5591184 CAGCACATCTGGCAGGATCTGGG + Intergenic
926278398 2:11424163-11424185 CAGGACATCTGGTTGTTTCCAGG + Intergenic
926919667 2:17927874-17927896 CACCTCAGCTGCCAGTTTTCTGG + Intronic
927995856 2:27485446-27485468 CAGCAAATTTGGCATTGTTCTGG + Exonic
928738521 2:34321680-34321702 CATCACATGTGCAAGTTTTCTGG + Intergenic
928914589 2:36457507-36457529 CAGCACATCTGTCAGTGTTAGGG + Intronic
930329875 2:49968917-49968939 CATGACATCTAGCAGTGTTCTGG + Intronic
930373623 2:50536625-50536647 CAGAACAACTGGCAGCTCTCTGG + Intronic
932098035 2:68869413-68869435 CAGCACCTCTGCCAGTCTGCAGG - Intronic
935493112 2:103745027-103745049 CAGCACTTTTTGCAGTTTTGTGG + Intergenic
936092902 2:109512348-109512370 CAGCACATCAGGTGGTTTGCTGG - Intergenic
939168679 2:138667999-138668021 CACTACATTGGGCAGTTTTCAGG - Intergenic
939558589 2:143707096-143707118 GAGCACATCATGCAATTTTCTGG - Intronic
939654438 2:144805954-144805976 AAGTACATTTGGCAGCTTTCAGG - Intergenic
940548770 2:155124712-155124734 AACAACATCTGGCATTTTTCAGG - Intergenic
942382165 2:175403368-175403390 CAGCACATGTGTCAGCTTTTTGG + Intergenic
942788007 2:179723188-179723210 CAATGCATCTGGCAGTATTCTGG + Intronic
943697288 2:190950177-190950199 CAGAACATCTGGCTGGTCTCAGG - Intronic
946952916 2:224896970-224896992 CAGCATATCTGGTAGGATTCAGG - Intronic
947670826 2:231934390-231934412 CACCACCTGTGGCCGTTTTCGGG + Intergenic
947839619 2:233199231-233199253 CACCACACCTGGCATTTTTATGG - Intronic
947839643 2:233199380-233199402 CACCACACCTGGCATTTTTATGG - Intronic
948451152 2:238073519-238073541 CAGCAATTTTTGCAGTTTTCAGG + Intronic
1169147051 20:3259613-3259635 CAGCACAGCTGGGAGTTTTAGGG + Intronic
1173626080 20:44474017-44474039 CACCACATCCGGCTGTTTTGGGG + Intergenic
1174668935 20:52287770-52287792 CAGCATATCTGGAAGTCCTCAGG - Intergenic
1178267084 21:31153604-31153626 CAACAGACCTGGCAGTCTTCTGG + Intronic
1178810631 21:35878144-35878166 CAGCAGAGCTGGCAGTTCTCAGG + Intronic
1181539021 22:23563334-23563356 GAACACATCTGGCCGGTTTCTGG - Intergenic
1183631093 22:39033061-39033083 CACCACATCTGGCTTTTTTTTGG - Exonic
1184844829 22:47075354-47075376 CAGCATCTCTGGGAGTTCTCAGG - Intronic
950498648 3:13349769-13349791 CAGCACAACTTGCAGTGTTTTGG - Intronic
951285926 3:20813754-20813776 CAGGAATTCTGGCAGTCTTCAGG + Intergenic
952460090 3:33515494-33515516 CAGCACAACTGGCTGATTTTTGG - Intronic
953592925 3:44277371-44277393 CATCACATCTAAGAGTTTTCTGG + Intronic
954431937 3:50475524-50475546 CAGCACATTTTGCAGCTTCCGGG + Intronic
955507813 3:59649223-59649245 GTGCAGATCTGCCAGTTTTCTGG - Intergenic
955596717 3:60598926-60598948 CAGCACATCTGTCAGTGATTTGG - Intronic
959659951 3:108856505-108856527 CATCACCTTTGGCAGTTTTCAGG + Intergenic
960088558 3:113616094-113616116 CAGCAGATTTGGGAATTTTCCGG + Exonic
960643967 3:119857519-119857541 CAGCAAATCAGTCACTTTTCAGG + Intronic
961964436 3:130887915-130887937 CACCACAGCTGGCAATGTTCTGG + Intronic
966151099 3:176868565-176868587 CACCACAGCTGGCAGTGTGCTGG - Intergenic
966772323 3:183515060-183515082 TTGCACATGTGGCATTTTTCTGG + Intronic
969591103 4:8122357-8122379 CACCACATCTGGTATTGTTCTGG - Intronic
969762543 4:9199549-9199571 CACCACAGCTGGCAGTCTTTTGG + Intergenic
974408036 4:61501190-61501212 TAGTACATCTAGCAGTTTTCTGG - Intronic
975221420 4:71816806-71816828 AAACACATCTGGCAGATATCTGG - Intergenic
977027864 4:91843181-91843203 CACCTCATGTGACAGTTTTCAGG + Intergenic
978728381 4:111997339-111997361 CAATACATCTGCCTGTTTTCTGG - Intergenic
978728419 4:111997600-111997622 CAGCGCAGCTGCCAGTGTTCTGG - Intergenic
979280883 4:118866329-118866351 CAGCACATCTGACAATGTTTGGG - Intronic
979679415 4:123443478-123443500 CAGCAGATCTGGGACTGTTCAGG - Intergenic
981856230 4:149296329-149296351 CATCACACCTGTCAGATTTCCGG + Intergenic
982601133 4:157451132-157451154 CAGAAGATGTGTCAGTTTTCTGG - Intergenic
986089918 5:4493930-4493952 CAGCAAAGCTGGGGGTTTTCAGG - Intergenic
987322972 5:16787368-16787390 CGGGACATCTGGCATATTTCTGG - Intronic
990987935 5:61658610-61658632 TAGCAAGTCTGGCAGTTTTTGGG + Intronic
992979792 5:82157035-82157057 CAGCACATCTGGCAGTTTTCTGG - Intronic
995290272 5:110443673-110443695 CACCACAGCTGGGAGTGTTCTGG + Intronic
995991157 5:118241203-118241225 CGGCACATATTGCAGTTCTCAGG + Intergenic
996945021 5:129056139-129056161 CACCACAGCTGGGAATTTTCTGG - Intergenic
999019338 5:148146354-148146376 CACCACATCTGGCTGGCTTCTGG + Intergenic
1006214508 6:32428821-32428843 CACATCATCTGGCAGTTTTGGGG - Intergenic
1006370926 6:33643201-33643223 CAGAACTTCTGGGAGTCTTCAGG - Intronic
1006629065 6:35418414-35418436 CTGCACATCTGGCAGTCCTCAGG - Intronic
1012696724 6:102393144-102393166 CATCATATCTAGCAGCTTTCGGG - Intergenic
1022336000 7:29422778-29422800 CAGCCCCTCTGGGAGATTTCTGG - Intronic
1022647972 7:32249125-32249147 CTTCACAGCTGGCAGTGTTCAGG + Intronic
1022864393 7:34401946-34401968 CAGCTCCTCTGGCTGTTTTAGGG - Intergenic
1023806540 7:43876824-43876846 CAGCACATCTGGCACATCCCAGG - Exonic
1024428596 7:49260025-49260047 CTGCTCATCTGGCTGTTTCCTGG + Intergenic
1024585311 7:50836818-50836840 CATCACATGTGCCAGTTTCCAGG + Intergenic
1027928869 7:84505060-84505082 CAGCTCATCATGCTGTTTTCTGG - Intergenic
1029113704 7:98226000-98226022 CAGCACATAGGGCAGTTCTGGGG + Intronic
1030074292 7:105723055-105723077 CAGCACCACTGCCAGTTTTTAGG + Intronic
1034581798 7:152050193-152050215 CACCACATCTGGGAGTGTGCTGG + Intronic
1035831615 8:2700999-2701021 CAGCACATCCGGCAGTTTTCTGG + Intergenic
1036272627 8:7321284-7321306 CACCACAGCTGGCAGTCTTTTGG + Intergenic
1036348721 8:7989060-7989082 CACCACAGCTGGCAGTCTTTTGG - Intergenic
1036843987 8:12149532-12149554 CACCACAGCTGGCAGTCTTTTGG - Intergenic
1036865358 8:12391853-12391875 CACCACAGCTGGCAGTCTTTTGG - Intergenic
1037448651 8:18994547-18994569 CAGCACATCTGCCATATTTCAGG - Intronic
1038201332 8:25415805-25415827 CATCACACCTAGCATTTTTCTGG + Intronic
1039157809 8:34581338-34581360 TAGAATATCTGTCAGTTTTCTGG - Intergenic
1043615015 8:82114656-82114678 CAGCCCATATGGCAGTTCTGAGG + Intergenic
1046497628 8:115035595-115035617 CAGTAGACATGGCAGTTTTCTGG - Intergenic
1047211352 8:122842794-122842816 CAGAACTTCTGGGAGTGTTCAGG - Intronic
1048289671 8:133171170-133171192 CAGCAGATGTGGCAGGTTCCTGG - Intergenic
1049254367 8:141605888-141605910 CTGCACAACTGATAGTTTTCTGG + Intergenic
1050422901 9:5485266-5485288 CAGGACATCTGGCAGGGTCCGGG + Intergenic
1056258446 9:84824206-84824228 CAGCACCTGTGTCACTTTTCTGG - Intronic
1056459324 9:86794247-86794269 ATGCACATCAGTCAGTTTTCAGG + Intergenic
1056788842 9:89612324-89612346 CAGAACATCTCTCTGTTTTCAGG - Intergenic
1057256954 9:93557632-93557654 CAATACTTATGGCAGTTTTCTGG - Intronic
1057450655 9:95155870-95155892 CACCACATCTGGCTTTTTTTGGG + Intronic
1057636099 9:96769144-96769166 CACCACACCTGGCTGTTTTGAGG - Intronic
1061275141 9:129565823-129565845 GAGCACACCTGGCTGGTTTCTGG - Intergenic
1062475105 9:136722834-136722856 CAGCACATCTGCCAGGTTAGGGG - Intronic
1190061610 X:47215212-47215234 CACCACACCTGCCAGTTTTCTGG + Intergenic
1194160412 X:90442570-90442592 CAGCACAACTGGTACTTTTATGG + Intergenic
1194375309 X:93125387-93125409 CAGCTCATCTGGCTGGCTTCTGG - Intergenic
1197674606 X:129315739-129315761 CAGCATATCTGGGAGTATTTGGG + Intergenic
1200506700 Y:4019517-4019539 CAGCACAACTGGTACTTTTATGG + Intergenic