ID: 992982887

View in Genome Browser
Species Human (GRCh38)
Location 5:82195013-82195035
Sequence CTGTGAATAAGCAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992982887_992982889 9 Left 992982887 5:82195013-82195035 CCATCTTCCTTGCTTATTCACAG 0: 1
1: 0
2: 5
3: 33
4: 356
Right 992982889 5:82195045-82195067 ACTCTTGTCTCATTGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992982887 Original CRISPR CTGTGAATAAGCAAGGAAGA TGG (reversed) Intronic
902000344 1:13188097-13188119 CCCAGAATAAGCCAGGAAGAAGG + Intergenic
903597825 1:24509507-24509529 CTGTGAATGAGCAAAGAGGGTGG - Intronic
904761342 1:32806610-32806632 CTCTGAAGAGGAAAGGAAGAGGG + Exonic
905957709 1:42012768-42012790 CTGTCTACAAGCCAGGAAGAGGG + Intronic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
906959955 1:50414208-50414230 TTGGGAGTAAGTAAGGAAGAGGG - Intergenic
908044555 1:60154568-60154590 CTGGCACTAAGCATGGAAGAGGG + Intergenic
908187435 1:61665949-61665971 CTGTGAAGAAGAAAAGAAGTTGG + Intergenic
911754793 1:101541039-101541061 CTTTGAATAAGCAATGGAGGAGG - Intergenic
912233864 1:107827291-107827313 TGGAGAATAAGGAAGGAAGAGGG - Intronic
915507004 1:156364148-156364170 CTGTGTACAAGCTAGGAAGAGGG - Intronic
915592585 1:156879099-156879121 CTGTGAACAAGAAAAGGAGAGGG - Intronic
916962051 1:169898372-169898394 CTATGCATAAGAAAGGCAGAAGG - Intergenic
917035406 1:170742798-170742820 CTGTGAAAAAGCAACCAGGAGGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
918248609 1:182682251-182682273 CTGGGATTGAGAAAGGAAGATGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919336188 1:196238174-196238196 CTGTTAATAATCAAGGATAAAGG - Intronic
919575900 1:199309252-199309274 ATTTGAATAAACAAGGAAAAGGG - Intergenic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
920242865 1:204566344-204566366 ATTTGAATAAACCAGGAAGAAGG - Intergenic
923184265 1:231554797-231554819 CTGTCAAGAAGCAGGTAAGATGG + Intronic
923429815 1:233909237-233909259 CTGTAAACAAGGAAGTAAGAAGG + Intronic
923650007 1:235865331-235865353 CAGAGAAAAAGCACGGAAGAGGG - Intronic
1064882483 10:20071705-20071727 CTGCGAATAAGCAATAGAGAAGG + Intronic
1064942065 10:20746256-20746278 ATGTGACTAAGAAAGAAAGATGG - Intergenic
1065008539 10:21401705-21401727 CTGTCTATGAGCCAGGAAGAGGG - Intergenic
1065803413 10:29373076-29373098 CTGTCTACAAGCCAGGAAGAGGG - Intergenic
1067811913 10:49435696-49435718 GTATTAAAAAGCAAGGAAGAGGG + Intergenic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068041822 10:51834642-51834664 CTGTCAAAAAGAAAGAAAGAAGG + Intronic
1068302397 10:55161251-55161273 ATGAGAATAAGCAAAGAGGAAGG + Intronic
1069461692 10:68600680-68600702 CTCTGCAGAAGCAAGCAAGATGG + Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1073326905 10:102648455-102648477 CTCTGAAAATGCAAGGAACAGGG - Intronic
1074270169 10:111945524-111945546 CTGTGAAATAGCAAGGATGGCGG - Intergenic
1075226813 10:120637039-120637061 CTGTGGCAAATCAAGGAAGAGGG + Intergenic
1075357795 10:121798095-121798117 ATGTTAATGAGCAAGGCAGAAGG - Intronic
1077164779 11:1130123-1130145 TTGTGAATGAACAAGGAACAAGG - Intergenic
1077996722 11:7459018-7459040 CAGTGTAGAAGCAAGGAACATGG + Intronic
1079571606 11:21950503-21950525 TTATGCATAAGCAAGGAAAATGG - Intergenic
1080781048 11:35430559-35430581 CTTTGATTAAGCCAGGAGGATGG + Intergenic
1080792918 11:35537379-35537401 CTGTCAATGAGCATGGGAGAGGG - Intergenic
1081385830 11:42471701-42471723 CTGTGAATGAGCCAGGAACAAGG + Intergenic
1082071580 11:47943834-47943856 CTGTGAAAAAGCAAGAATAATGG - Intergenic
1082869186 11:57928256-57928278 CTGGGAATAAAGAAGGAATAAGG + Intergenic
1083051445 11:59780352-59780374 CTGTCTACAAGCCAGGAAGAGGG + Intronic
1084951389 11:72667924-72667946 CTGAGAAGAAGCATGGAGGAGGG + Intronic
1086839482 11:91667290-91667312 CTGTGAATCAGCAAAGATGGTGG - Intergenic
1087084159 11:94199565-94199587 CTGTGATTCAGAAAGGCAGATGG - Intergenic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1088358918 11:108970839-108970861 CTGGGAAAAAGCAAGTAAAAAGG + Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1089149470 11:116353813-116353835 GAGTGAAGGAGCAAGGAAGAGGG - Intergenic
1089554072 11:119305360-119305382 CTCTAAATAAACACGGAAGAAGG - Exonic
1090208988 11:124902792-124902814 CTGGGATTAAGCAATGAATAGGG - Intergenic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091822801 12:3489307-3489329 CTGTGACTAACCAGGGAGGAGGG - Intronic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097342008 12:58449543-58449565 CTGAGAATAAGCAGGGATAAGGG + Intergenic
1097785869 12:63758295-63758317 ATCTGAATAAGCATGGAAGCAGG - Intergenic
1098144772 12:67487295-67487317 CTGTGAAACAGCAAGGATGGTGG - Intergenic
1099666178 12:85632160-85632182 CTTTGCATAAAAAAGGAAGAAGG - Intergenic
1100207151 12:92363279-92363301 CTGTAAATCAGCTATGAAGATGG - Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100481483 12:94983805-94983827 CTGTGAAGAATAAAGGAAGGAGG - Intronic
1101588991 12:106109911-106109933 CTCTGAAAAAGAAAGGAAGAAGG - Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1102799151 12:115716459-115716481 CTGTGAAGAATAAAGGAAGCAGG + Intergenic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103186866 12:118965834-118965856 TTATAAATAAGAAAGGAAGATGG - Intergenic
1103245749 12:119455725-119455747 CTCTGAAAAAGAAAGAAAGAAGG + Intronic
1106003837 13:25750379-25750401 ATGAGAGTAACCAAGGAAGAGGG - Intronic
1107669631 13:42731507-42731529 GTGTGAATGAGGAAGGAAAAAGG + Intergenic
1108075838 13:46678946-46678968 CTCTGAATAAATAAGGAAGGAGG - Intronic
1108571162 13:51752770-51752792 CTCTAAATAAGCAATGGAGATGG + Intronic
1108642483 13:52395670-52395692 CTGTGAAGAAGCAAGCAGGGAGG + Intronic
1109043944 13:57382588-57382610 CTGTCTACAAGCCAGGAAGAAGG + Intergenic
1109183898 13:59246916-59246938 GAGGGAATAAGCTAGGAAGATGG + Intergenic
1109481968 13:62966810-62966832 ATGTTAATAAGGAAGGAAGTTGG + Intergenic
1110067948 13:71132571-71132593 CTAGGAATAGGCAAAGAAGAAGG + Intergenic
1111862650 13:93727893-93727915 CTGTGAAGCAGCCAGGAAGGAGG - Intronic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1113007701 13:105725922-105725944 CCGTGAAGAAGGAAGGAAGTCGG - Intergenic
1113626867 13:111854194-111854216 CTGGGAATCAGCAAGGTACAAGG + Intergenic
1114498840 14:23153380-23153402 CTGTGTATAATGAAGGAAGGCGG - Intronic
1114950640 14:27748165-27748187 CTGTGAAGAACCCTGGAAGAAGG + Intergenic
1116140398 14:40986127-40986149 TTGTGAATAAGCCAGGTAAATGG - Intergenic
1116280804 14:42904356-42904378 CTGTATACAAGCAAGGAAGCAGG - Intergenic
1118800630 14:69186309-69186331 CTTAGTATAAGCAAGGAAGAAGG + Intergenic
1119401846 14:74368054-74368076 CAGTGAATGAGCAGAGAAGATGG + Intergenic
1119863345 14:77953142-77953164 CTGTCTATAAGCCAGGAAGCAGG + Intergenic
1120202546 14:81553649-81553671 CTGTCAAAAAGAAAGAAAGAAGG - Intergenic
1120222344 14:81748565-81748587 CAGTGAAGAAGAGAGGAAGAAGG + Intergenic
1120303643 14:82739283-82739305 GTGAGAATAAGCAACGGAGAAGG - Intergenic
1120380738 14:83775852-83775874 GGGTGAATAGACAAGGAAGAAGG + Intergenic
1120535829 14:85693395-85693417 ACGTGAATAACTAAGGAAGAAGG - Intergenic
1121028633 14:90637827-90637849 CTCTTAATAAACCAGGAAGAAGG + Intronic
1122832206 14:104403984-104404006 CTGCGAATGAGAAAGGAAGAAGG + Intergenic
1124821956 15:33054874-33054896 CTGAGAGTAACCAAGGAACAAGG + Intronic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1127658379 15:61076913-61076935 CTTTGAACAAGCAAGGGAGAGGG - Intronic
1128894234 15:71357870-71357892 CTTTGAATAAGTAAGGCAGTTGG - Intronic
1129624971 15:77187617-77187639 CTGTTAATAATAAAGGAGGATGG + Intronic
1130785644 15:87092963-87092985 CTGTAAATAAGTAATGTAGAAGG - Intergenic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1133312718 16:4860649-4860671 CTGTGAAGCTGCAAGCAAGAGGG - Exonic
1133665833 16:7966841-7966863 CTGAGAAAAAGTAAGGAACACGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1138233028 16:55353683-55353705 CTGTCTACAAGCCAGGAAGAGGG + Intergenic
1138612981 16:58142122-58142144 CTGGGAATAAGCAGACAAGATGG - Intergenic
1139029828 16:62866522-62866544 CTGTTAATAGGGAAGAAAGAAGG + Intergenic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1143854224 17:9836717-9836739 ATGTGAATAAGCATGGAGAATGG + Intronic
1145356821 17:22165948-22165970 ATGTTAATAAGGAAGGAAGTTGG - Intergenic
1145884889 17:28375032-28375054 CTGAGAAGAAGAAAGCAAGAGGG - Intronic
1149649864 17:58269954-58269976 CAGTGAATAAGCAAGAAATCAGG + Exonic
1149815982 17:59724261-59724283 CTGAAAATAAGAAAGGAAAAAGG + Intronic
1150977474 17:70104726-70104748 ATGTAAATAGGCATGGAAGAAGG + Intronic
1152999888 18:445025-445047 CTGTGAATATCCTAAGAAGAGGG - Intronic
1153289839 18:3489936-3489958 CTGTGAAGAAGAAAGAAAGAAGG + Intergenic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1154966964 18:21368375-21368397 ATGTTAATAAGCTAAGAAGATGG + Intronic
1155913102 18:31527852-31527874 CTGTGTATAAGCCAGAAAGCGGG - Intronic
1156765034 18:40642424-40642446 CTCTGCATAATCAAGGAAGAAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158059676 18:53324455-53324477 CTCTGAAGAAGCATGGTAGAGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158814116 18:61074013-61074035 CTGAGAATAAGCAACAAACATGG + Intergenic
1158994356 18:62902207-62902229 CTGTGATGAAGCAAGGCACAGGG - Intronic
1159648704 18:70952109-70952131 AAGTGAATAGGAAAGGAAGAAGG + Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1160117299 18:76092112-76092134 CTATGAATAACCAAAGAAAATGG - Intergenic
1162885470 19:13693893-13693915 TAGAGAATAAGCAAGAAAGAGGG + Intergenic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1165544713 19:36525350-36525372 CTGTGGATATACAAGGAAGCAGG + Exonic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166626572 19:44362635-44362657 ATGTAAATAAACTAGGAAGACGG - Intronic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
925424518 2:3737527-3737549 CTGTTGAAAAGCAAGGTAGAAGG - Intronic
926569083 2:14509750-14509772 CTGAGTATTACCAAGGAAGAAGG - Intergenic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
927256705 2:21045768-21045790 ATGTGAATATGCATGGAAGCAGG - Intergenic
927983073 2:27387268-27387290 CTAGAAATAAGAAAGGAAGAAGG + Intronic
928220589 2:29399793-29399815 ATGTGAAAATGCAAGGAAGAAGG - Intronic
928231793 2:29504968-29504990 CAGTGAGCAAGCAAGGATGAGGG + Intronic
928302756 2:30141193-30141215 CTGTCTATAAGCCAGGAAGCAGG + Intergenic
928940167 2:36719127-36719149 ATCTGAATAAGCAAGCCAGAAGG - Intronic
929652957 2:43700539-43700561 CTGTGACTCAGCAAAGAAGGTGG + Exonic
929745462 2:44652943-44652965 ATGTGAATAAGAAGGGAAGCAGG - Intronic
930566662 2:53029027-53029049 CTGTCTATAAACCAGGAAGACGG + Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931772775 2:65512997-65513019 CTGTGACCATGCAAGAAAGAAGG + Intergenic
931933173 2:67164507-67164529 ATGTCTACAAGCAAGGAAGAGGG + Intergenic
931964480 2:67518205-67518227 CTGAGTATTGGCAAGGAAGAAGG + Intergenic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932294185 2:70610414-70610436 CTGTCCACATGCAAGGAAGAGGG - Intronic
933603819 2:84360528-84360550 CTGTGAAAAAGCAAAGATGGTGG - Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934160435 2:89244497-89244519 CTGTGAGTAAACAAGCAAGATGG - Intergenic
934206842 2:89937941-89937963 CTGTGAGTAAACAAGCAAGATGG + Intergenic
935222851 2:101029515-101029537 CTGTGCAGCAGCAAGGATGATGG - Exonic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
937484112 2:122295927-122295949 CTTTGAATAAGTAAGGCAGGTGG - Intergenic
938546915 2:132341753-132341775 GTGTAAATAAACTAGGAAGACGG + Intergenic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
939291814 2:140205476-140205498 GTGTCAAAAAGTAAGGAAGAAGG - Intergenic
939814395 2:146875930-146875952 CTGTCTATAAGCCAGGAAAAAGG + Intergenic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
941766566 2:169303719-169303741 CTATAAATAAACAAGGTAGAGGG + Intronic
943559963 2:189449228-189449250 CTGTGACTAATCCAGGAAAATGG - Intronic
943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG + Intronic
944152289 2:196572812-196572834 CTGTCTATAAGCCAGAAAGAGGG + Intronic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944486271 2:200209638-200209660 CTGAGAATAAGGGAAGAAGATGG + Intergenic
944885958 2:204062977-204062999 CTGTCAAAAAGAAAGAAAGAAGG - Intergenic
945126449 2:206516518-206516540 TTGTCTATAAGCCAGGAAGAGGG - Intronic
945487138 2:210409613-210409635 CTATGAATGAGCAAGGAAAGTGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946375301 2:219304637-219304659 ATGTGAATAAGCAAGGAGGCAGG - Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946594214 2:221288351-221288373 CTGTGAGTAAGCTTGGAAGCTGG - Intergenic
947401186 2:229732924-229732946 CTGGAAATAAGCAGGCAAGATGG - Intergenic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947898180 2:233694754-233694776 CTGTGAAAAGGCAAGGGTGAGGG + Intronic
948094912 2:235325626-235325648 ATTTGAATGAGAAAGGAAGAAGG - Intergenic
948188474 2:236040452-236040474 CTGTGAATACGCATGGACCATGG - Intronic
948694882 2:239728192-239728214 CTGCGAAGCAGCCAGGAAGACGG - Intergenic
1168949433 20:1786506-1786528 CTGTGAATATTCAAAGAAGAAGG - Intergenic
1169789746 20:9397216-9397238 TTGTGAATGAGCAAAGAAGGTGG - Intronic
1170057194 20:12219443-12219465 CACTGAATAAGCTGGGAAGAGGG + Intergenic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171875781 20:30574486-30574508 ATGTAAATAAACTAGGAAGACGG + Intergenic
1171971440 20:31567368-31567390 CTCTGAATACACAAGGCAGAGGG + Intronic
1172410444 20:34717982-34718004 ATGGGAACAAGCAAGGAAGGAGG - Intronic
1173098125 20:40057543-40057565 CTGTCTACAAGCCAGGAAGAGGG + Intergenic
1173445747 20:43116528-43116550 ATGTGAATAAGTAAGGCAGGTGG - Intronic
1174781680 20:53395300-53395322 CGATGAGTAAGCAAAGAAGAAGG + Intronic
1175104227 20:56602985-56603007 CTGGGAAAAAGCCAGGAAGATGG + Intergenic
1175409449 20:58756536-58756558 ATGAGACTAAGCAAGGGAGATGG + Intergenic
1175713725 20:61241492-61241514 CTTTGAATAGGGTAGGAAGATGG + Intergenic
1175751539 20:61501537-61501559 CTGAGATTCAGCAAGGATGAGGG - Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179505674 21:41838670-41838692 CTGTGAATAGGCAGAGAAGATGG - Intronic
1181129995 22:20725596-20725618 CTATCAATAAGCCAGGGAGATGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1185072417 22:48663735-48663757 GTGTGAATATGCCAGGAAAAGGG - Intronic
949531352 3:4958765-4958787 CTGTGAAAAAGCAAGAAAATAGG + Intergenic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
952206863 3:31188970-31188992 CTGAAAAGAAGAAAGGAAGAGGG + Intergenic
953719602 3:45343876-45343898 CTGGTAAAAATCAAGGAAGAAGG - Intergenic
953754477 3:45634804-45634826 CTGGGAATATGCAGGGCAGATGG + Intronic
955797411 3:62652172-62652194 CTTGTAATATGCAAGGAAGATGG + Intronic
956716273 3:72082967-72082989 CTGTCTACAAGCCAGGAAGAGGG - Intergenic
957613703 3:82502184-82502206 CAGTGAAAAATCAATGAAGATGG + Intergenic
959568011 3:107852535-107852557 CTGTGTATGAACCAGGAAGAGGG + Intergenic
960519992 3:118643677-118643699 CTGTGACTATACAAGAAAGATGG - Intergenic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963530233 3:146465754-146465776 CTGTGAATAGCCCAGGGAGAAGG + Intronic
963923642 3:150929020-150929042 CTGTGGAAAAACAAGAAAGAGGG + Intronic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
966000581 3:174944132-174944154 CTGTGAAACAGCAAAGATGAGGG + Intronic
966071731 3:175886057-175886079 GTGAGAAAAAGCAAGGTAGAGGG - Intergenic
967854917 3:194110225-194110247 CTCTCAATAAGAAAGCAAGAGGG - Intergenic
967890694 3:194362373-194362395 CTGTGGATAAGCATGGAACAAGG - Intronic
968973210 4:3807139-3807161 CTGTCAAAAAGAAAGAAAGAGGG - Intergenic
970351764 4:15208568-15208590 CTATGAGAAAGCAATGAAGATGG - Intergenic
971873261 4:32272516-32272538 GAGTGCATAAGCAAGTAAGATGG + Intergenic
972640126 4:40917622-40917644 CTGTGAATTATAAAGGTAGAGGG + Intronic
972727464 4:41757808-41757830 TTATGAATAAGCAAGGGAGTTGG - Intergenic
973251839 4:48068806-48068828 CTGTTTATAAGCCATGAAGAGGG - Intronic
973624959 4:52762421-52762443 CTGTGAATAAAAGAGGAAGAGGG - Intergenic
974996828 4:69171110-69171132 CTGTGAAGAGGAAAGGAACACGG + Intronic
977619952 4:99125147-99125169 CTGCAAAGAAGCAAGGAAGTGGG - Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
979484010 4:121249890-121249912 CTGAGAATAAGGAAGGAACCTGG - Intergenic
980004752 4:127528867-127528889 CAGTTAATAAGCATAGAAGAAGG + Intergenic
980686601 4:136237767-136237789 CTGTGAAATAGCCAGGAATAAGG + Intergenic
980706922 4:136510150-136510172 TTATGAATAAGCAAGGAAAGTGG - Intergenic
981365890 4:143902660-143902682 GGTTGAATAAGCAAGGAAGGAGG - Intronic
981375996 4:144016474-144016496 GGTTGAATAAGCAAGGAAGGAGG - Intronic
981386522 4:144137833-144137855 GGTTGAATAAGCAAGGAAGGAGG - Intronic
983078013 4:163349371-163349393 TTGTAAATAAACAAGGTAGATGG + Intronic
983123807 4:163923541-163923563 CTTAGGATAAGCAAGGAAGAAGG + Intronic
983317848 4:166154861-166154883 CTGTGCATAAGCAAAGGAGTTGG + Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
983923967 4:173376261-173376283 CAATGAAAAAGCAAGGAAGCAGG + Intronic
984616001 4:181898490-181898512 ATGTGAATAAGCAAAGTTGATGG - Intergenic
984793453 4:183635471-183635493 TTGAGAATAGGCAAGCAAGAGGG - Intergenic
984956631 4:185051830-185051852 ATGTTACTAAGGAAGGAAGAGGG - Intergenic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985866589 5:2519135-2519157 CTGGCATTAAGCATGGAAGAGGG + Intergenic
986382853 5:7204140-7204162 ATGAGAATAAGCAAGGAAGTTGG + Intergenic
987963748 5:24845660-24845682 CTGTCAACAAGCCAGGAAAAGGG + Intergenic
989390403 5:40894585-40894607 TTGTGAATAAGCCAGGAAGAAGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
989994369 5:50810692-50810714 GTGTGAATAAACAAGGAAAAGGG + Intronic
990431397 5:55738297-55738319 CAGTGAAGAAGCCAGGAATAAGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
992181931 5:74205912-74205934 CTGTGTATAAGCCAGGAAGAAGG + Intergenic
992330558 5:75713696-75713718 CTGTAAATAAGCAGGAAAGGAGG + Intronic
992938555 5:81738144-81738166 CTGTTAAAAATCAAGCAAGATGG + Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
996408785 5:123133130-123133152 CTGTGAATATGAAAGTAAAAAGG + Intronic
999087060 5:148902271-148902293 CTGGGGACAAGCAAGAAAGAGGG - Intergenic
1000829394 5:166084299-166084321 GTGTGAAGGAGAAAGGAAGAAGG - Intergenic
1000847656 5:166301458-166301480 GAGTGAGGAAGCAAGGAAGAGGG + Intergenic
1000996456 5:167964072-167964094 CTGTGAATAGGCTGGGAGGAAGG - Intronic
1001754931 5:174160966-174160988 GGGAGAATAAGCAGGGAAGAGGG + Intronic
1003314259 6:4997501-4997523 CTGAGAATCAGGAAAGAAGATGG - Intronic
1004006757 6:11643934-11643956 CTCTGAACAAGTAATGAAGATGG - Intergenic
1004070006 6:12289247-12289269 AAGTGAATATGCAAGGAAGGTGG - Intergenic
1004078107 6:12363959-12363981 CTGTGCATAACCATGGTAGAAGG + Intergenic
1006849185 6:37085175-37085197 CTTTGAATAAGAAAAGATGAAGG - Intergenic
1006899786 6:37492636-37492658 CTGTGAATTAGCAAGTGAAAGGG - Intronic
1007616538 6:43182801-43182823 GTGAGAATAAGAATGGAAGAAGG - Intronic
1008387907 6:50915580-50915602 TTGTGAATAGGCAACGAACATGG + Intergenic
1008711839 6:54237026-54237048 CTGTGAATAATCAATAATGAGGG + Intronic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1008874613 6:56312263-56312285 ATGCAAACAAGCAAGGAAGAAGG + Intronic
1009451533 6:63806299-63806321 CCGTGAATAAGCCAGGAATGAGG + Exonic
1009489987 6:64277742-64277764 ATTTGAATAATCAAGGAGGATGG + Intronic
1009897041 6:69764389-69764411 CTATCTATAAGCATGGAAGAAGG + Intronic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1010291462 6:74142698-74142720 CTAGGAATAAGCACAGAAGAGGG + Intergenic
1011449321 6:87476042-87476064 CTGGGAATAAGGAAGTATGAGGG + Intronic
1011824225 6:91287429-91287451 CTGGACATAAGCAATGAAGAAGG + Intergenic
1011871052 6:91893243-91893265 ATGTGAAGAACCTAGGAAGAGGG + Intergenic
1012053880 6:94380142-94380164 TTGTGAACAAGCAGGAAAGATGG - Intergenic
1012635890 6:101541196-101541218 CAGTGAATTAGAAAGGAAGTTGG + Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013774455 6:113664145-113664167 CTGGGAAGCAGCAAGGGAGAAGG - Intergenic
1014983716 6:127977055-127977077 CTGTGAAGAAACAAGGTAGATGG + Intronic
1015023407 6:128504361-128504383 CTGTCAATGAGCAAGGAGCAAGG + Intronic
1015440004 6:133237054-133237076 CTGAGTGTAAGCATGGAAGAAGG + Intergenic
1016546477 6:145229639-145229661 ATGTGAACAAGAAAGAAAGAGGG - Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1019045509 6:169142390-169142412 CTGAGAATAAGCAAGTAAAAAGG + Intergenic
1020473332 7:8564843-8564865 CTGGAAATAAGCAAAGAAGCAGG + Intronic
1021013074 7:15495739-15495761 CTGTCTATGAGCCAGGAAGAAGG - Intronic
1021491202 7:21221278-21221300 CTTCGAGGAAGCAAGGAAGAAGG - Intergenic
1021847874 7:24780071-24780093 CTGCTAATAAGTAAGTAAGAAGG + Intergenic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1023658421 7:42449155-42449177 CAATGAATGAGTAAGGAAGACGG - Intergenic
1024153817 7:46600072-46600094 CTGTGAACCAGGAAGGAAGTAGG + Intergenic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024347858 7:48331045-48331067 GTCTGAATAAGGAGGGAAGAGGG + Intronic
1024395374 7:48860372-48860394 CTGAGAATAAGAAAAGGAGAAGG + Intergenic
1024399862 7:48911916-48911938 CTGAGAATAAGAAAAGGAGAAGG - Intergenic
1026276314 7:68880260-68880282 CTGTGAAAAGGCAAGGCATAGGG - Intergenic
1027593673 7:80145871-80145893 CTGGGAAAAACCAAGTAAGAAGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027648552 7:80836277-80836299 CTGTCAAAAAGCAAAGAAAAGGG - Intronic
1029562301 7:101310573-101310595 ACGTGAAAAAGCAAGGAAGTGGG + Intergenic
1029641754 7:101825188-101825210 GTGTGAATAGGAAGGGAAGATGG - Intronic
1029804423 7:102981661-102981683 CTGTGTATAAACCAGGAAGTGGG - Intronic
1030747845 7:113189616-113189638 CTGTGACTAAGCATACAAGAAGG + Intergenic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1031221622 7:118973806-118973828 CTGTCTATAAACCAGGAAGAGGG + Intergenic
1031574107 7:123394830-123394852 CTGTGGATAACAATGGAAGATGG + Intergenic
1031727083 7:125253255-125253277 CTGTGTATAAGCCAGGAAGAGGG + Intergenic
1031747001 7:125512036-125512058 TTATGAATAAGCAAGGAATGTGG - Intergenic
1031808635 7:126338442-126338464 CACTAAATAAGCAAGGAAGCAGG + Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032584413 7:133132945-133132967 CTGTAAATAAGCAAAGAAGAAGG + Intergenic
1032977038 7:137237272-137237294 CTGTCTATAAACCAGGAAGAGGG + Intronic
1035742777 8:1941075-1941097 CTGTGAATAAAAATGGCAGAAGG - Intronic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1036489186 8:9209096-9209118 CTGTTATTAAGCAAGGACAAAGG + Intergenic
1036685236 8:10905060-10905082 ATGGGAACAAGCCAGGAAGAAGG - Intronic
1037263535 8:17034781-17034803 CTATGAATGAGCAAAGAAAATGG + Intronic
1039161590 8:34627595-34627617 CTGAGAAACAGCAAGGAAGGTGG - Intergenic
1040493965 8:47949811-47949833 ATCTTGATAAGCAAGGAAGAAGG + Intronic
1040658208 8:49537867-49537889 ATCTGAATAAGAAAGAAAGAGGG + Intronic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1041292167 8:56318431-56318453 CTGTGGATCTGCAAGGATGAGGG + Intronic
1041483199 8:58345633-58345655 CAGTGAATGAGCAAGCAGGAAGG + Intergenic
1041705015 8:60837415-60837437 CTGTCCATAAACCAGGAAGAGGG - Intronic
1042540254 8:69900932-69900954 TAGTGAAGAAGAAAGGAAGAAGG - Intergenic
1043944670 8:86236082-86236104 TTGTGAATGAGCAAAGAAAATGG - Intronic
1044612109 8:94102109-94102131 CAGAAAGTAAGCAAGGAAGAAGG + Intergenic
1045705916 8:104922148-104922170 CTCTAAACAAACAAGGAAGAAGG + Intronic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1047489498 8:125362963-125362985 CAGTGAATAAGCAGTGGAGAGGG - Intronic
1047549796 8:125857963-125857985 CTATATATAAGCCAGGAAGAAGG + Intergenic
1048248599 8:132837649-132837671 CTAGGAATAAGCTAGGAATAAGG - Intronic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050199016 9:3121448-3121470 CTGTGAATAAGAATGTCAGATGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1052082315 9:24222371-24222393 CTGTGAATAGGCAGAGAGGATGG - Intergenic
1055193629 9:73559436-73559458 CTCTGAATAAGCTAGGAAGAAGG - Intergenic
1056589585 9:87955374-87955396 CTATAAATAAGAAAGGAAGAAGG - Intergenic
1056746697 9:89309921-89309943 CTGTGACTAAGTAATGTAGATGG - Intergenic
1057374191 9:94503695-94503717 CTGTACATAGGCAAGGAAAAGGG - Intergenic
1057404146 9:94752718-94752740 CTGTAGAAAAGCATGGAAGATGG - Intronic
1057939978 9:99273390-99273412 CTGTGAAATAGAAAGGAAAAAGG - Intergenic
1057998882 9:99845528-99845550 CTGAAAGGAAGCAAGGAAGATGG - Intronic
1058011365 9:99981154-99981176 TTGTGAATAAGAAAGTAGGATGG - Exonic
1059107340 9:111523138-111523160 CTGTGCATCAGGAAGGAAGCAGG - Intergenic
1060349038 9:122841497-122841519 ATGGGGATAAGCAAGGAAAATGG + Intergenic
1187046746 X:15654963-15654985 CTGTCAAGAGGCGAGGAAGAAGG - Intronic
1187052975 X:15713158-15713180 CTGTCAAGAGGCGAGGAAGAAGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1188643329 X:32534218-32534240 CTGTCTACAAGCCAGGAAGAAGG - Intronic
1188824205 X:34810171-34810193 CTATGAAAAATCAAGGAAGAAGG - Intergenic
1189197662 X:39165780-39165802 TTTTGAAAAAGCAAGGAAGAAGG - Intergenic
1190000695 X:46683619-46683641 CTGTGAATAAGGAAGGAGTGTGG + Intronic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193322932 X:80145650-80145672 CTGTGTATATTCAAGTAAGATGG - Intergenic
1193471583 X:81910504-81910526 CTGTGAATAAGACAGAAAAAGGG - Intergenic
1193667703 X:84342988-84343010 CTGTGATTAAGAAACAAAGAGGG - Intronic
1194759321 X:97775781-97775803 CTGTTAATAAGAAAGGCAGCTGG - Intergenic
1195654286 X:107320314-107320336 CAGTGCACAAGAAAGGAAGAGGG - Intergenic
1195981753 X:110585993-110586015 CTTTGAAGAATCAAAGAAGATGG - Intergenic
1196434786 X:115665023-115665045 CTTTGAGGAAGCCAGGAAGAAGG + Intergenic
1197047582 X:122017411-122017433 CAGTAAATAAGCATGGAAAATGG - Intergenic
1198110770 X:133501011-133501033 CTGTGAATAAGCACTGAAGTGGG - Intergenic
1198405769 X:136311038-136311060 CTGTCTACAAGCCAGGAAGAGGG - Intronic
1198971429 X:142285269-142285291 CTATCAACAAGCCAGGAAGAGGG - Intergenic
1199044942 X:143158877-143158899 CTGTGTCTTAGCATGGAAGAAGG + Intergenic
1199989739 X:152979729-152979751 CAGAGAAAAAGCAAGGAAGCAGG - Intergenic