ID: 992983013

View in Genome Browser
Species Human (GRCh38)
Location 5:82196654-82196676
Sequence GGGTGCCAAGATAATTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 4, 2: 31, 3: 152, 4: 527}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992983013_992983018 21 Left 992983013 5:82196654-82196676 CCCACTTAATTATCTTGGCACCC 0: 1
1: 4
2: 31
3: 152
4: 527
Right 992983018 5:82196698-82196720 TAGATGTATGCATTTATTTCTGG 0: 1
1: 108
2: 447
3: 1320
4: 3519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992983013 Original CRISPR GGGTGCCAAGATAATTAAGT GGG (reversed) Intronic
900008638 1:85730-85752 GGGAGCCAACATTATTCAGTGGG + Intergenic
900036872 1:419741-419763 GGGAGCCAACATTATTCAGTGGG + Intergenic
900058499 1:655480-655502 GGGAGCCAACATTATTCAGTGGG + Intergenic
901128543 1:6947077-6947099 GGATACCAAGATAATTCAATGGG - Intronic
901531411 1:9855512-9855534 GGGTGCCAAGACAATTCAGTGGG + Intronic
902726986 1:18343708-18343730 GGATGCCAAGATAATTCAATGGG - Intronic
903559745 1:24218341-24218363 GGCTGCGAAGAAAATAAAGTGGG - Intergenic
903611231 1:24614877-24614899 GAGTACCAAGATAATTCAATGGG - Intergenic
904274809 1:29374208-29374230 AGGTGCCAAGAACATTCAGTGGG - Intergenic
905078764 1:35298200-35298222 GGGTGCCAATAAAAGTCAGTAGG + Intronic
905195613 1:36274951-36274973 GGGTGCCAGGACAATTCAGTGGG + Intronic
905837956 1:41145327-41145349 GGGTACCAAGACAGTTCAGTGGG - Intronic
906099206 1:43246401-43246423 GGGTACCAAGATCATTTAGTAGG + Intronic
906830807 1:49029902-49029924 GGGTACCAAGACAATAAAGTGGG + Intronic
906959528 1:50409408-50409430 GGGTCCCAAGACAATTCAATGGG + Intergenic
907368690 1:53983243-53983265 GGGTGCCAAGATAATTGAAAGGG + Intergenic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908479338 1:64522216-64522238 GGGTGCCAAAACCATTCAGTGGG - Intronic
909226305 1:73027821-73027843 GTGTGCCAAGATAATTAAATGGG + Intergenic
909230062 1:73077035-73077057 AGGTGTCAAGGTAATTTAGTTGG + Intergenic
910112492 1:83697427-83697449 GGGGGAAAAGATTATTAAGTAGG - Intergenic
910502756 1:87911889-87911911 GAGTGCCAAGATAGTTCAGTGGG - Intergenic
911155465 1:94632340-94632362 GGGTGCCATGATAATTTACTAGG - Intergenic
911586857 1:99701318-99701340 GGGTGCCAGGATCACTCAGTGGG - Intergenic
911606179 1:99908283-99908305 GGGTGCCAAGACCATTCATTGGG - Intronic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
912342164 1:108927516-108927538 GGGTGCCAAGACCATTCAGTGGG + Intronic
912557674 1:110528077-110528099 GGCTGTCAAGATAATTAAAGGGG + Intergenic
914384023 1:147150170-147150192 GGGTGCCAAGACCATTCAATGGG + Intergenic
915165226 1:153944588-153944610 GAGTGCCAGGACCATTAAGTGGG - Intronic
915652242 1:157323215-157323237 GGATGCCCAGACAATTAAATGGG + Intergenic
915712506 1:157914488-157914510 GGGTGCCAAGAACATTCAATGGG + Intergenic
915725665 1:158015281-158015303 GGGGGCCAAAATAGCTAAGTAGG + Intronic
916259483 1:162826845-162826867 AGGTGCCAAGACCATTCAGTGGG - Intronic
916336925 1:163683006-163683028 GGGTGCCAAGATCAGTCAATGGG + Intergenic
917873834 1:179267144-179267166 GGATGCCAAGATATTTTAATGGG - Intergenic
918224498 1:182468896-182468918 GGGTGCCAAGACCATTCAATGGG + Intronic
918486726 1:185036523-185036545 GAGTCCCAAGATAATTATATAGG + Intergenic
918753244 1:188300550-188300572 GAGTGCCAAGAAGATTAAATGGG + Intergenic
919098147 1:193060983-193061005 AGGTACCATGTTAATTAAGTTGG - Intronic
919099695 1:193079408-193079430 GGGTGCCAAGATGATTCACTGGG + Intronic
919295382 1:195692524-195692546 GAGTGCCAAGATCATTGAGTGGG + Intergenic
919570139 1:199238072-199238094 GGGTGCCAAGACCATTCAATAGG - Intergenic
919867983 1:201797246-201797268 GAGTGCCAAGACAATTCAGTGGG - Intronic
921042278 1:211444874-211444896 GGGTGCCAAGATCACTCAGTGGG + Intergenic
922112316 1:222572678-222572700 GGGTGCCAAGACAATTCAGTGGG + Intronic
922540097 1:226412454-226412476 GGGTGCCAAGATCATTCAGTGGG - Intergenic
922882780 1:228994289-228994311 GGGTGCCAAGACAACTGAATGGG + Intergenic
922926790 1:229354350-229354372 GGGTGCCAAGACCATTCAATGGG - Intergenic
923864391 1:237923741-237923763 GGCTGCCAAGACAATTCAGGGGG - Intergenic
924220434 1:241869286-241869308 ATGTGCCAAGACAATTAAATGGG + Intronic
924284285 1:242470035-242470057 GGGTGCCAAGAAAATTGGGAGGG + Intronic
924505127 1:244675544-244675566 AGGTGCCAAGACAATTCAGTGGG - Intronic
924574936 1:245271017-245271039 GGGTGCCAAGACAACACAGTGGG - Intronic
1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG + Intronic
1065114352 10:22470198-22470220 TGGCACCAAGATAGTTAAGTGGG + Intergenic
1065120639 10:22526790-22526812 GGGTGCCAAGACAATTCAGTAGG - Intergenic
1065727811 10:28683277-28683299 GGGAGCCAAAATACTTAATTTGG - Intergenic
1065932380 10:30491117-30491139 GGGTTCCAAGGAAATTGAGTGGG + Intergenic
1066674077 10:37870279-37870301 GGGTGCCAAGACAATACAATGGG - Intergenic
1067159328 10:43809828-43809850 AGGTGCCAAGATATTTTATTGGG + Intergenic
1067381851 10:45781565-45781587 AGGTGCTAAGATATTTCAGTGGG + Intronic
1067513644 10:46916975-46916997 AGGTGCCAAGATAATATAATGGG - Intronic
1067648608 10:48134859-48134881 AGGTGCCAAGATAATATAATGGG + Intergenic
1067678665 10:48411378-48411400 GGGTGCCAAGACCATTCAATGGG - Intronic
1067770863 10:49123686-49123708 GAGTGCCAAGATAATTTAATGGG - Intergenic
1067889550 10:50122205-50122227 AGGTGCCAAGATATTTCAGTGGG + Intronic
1067978273 10:51051424-51051446 GGGTGCCAAGAATAATAAATGGG - Intronic
1068105081 10:52605008-52605030 GGGTGCCAAGACCATTAAATGGG + Intergenic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068414691 10:56704466-56704488 TGGTGTCAAGATAATGAAATGGG - Intergenic
1068469192 10:57438769-57438791 GGGTACCAAGACCATTCAGTGGG - Intergenic
1068931879 10:62598801-62598823 AGGTGCTAAGGTAATTAAATGGG + Intronic
1069152356 10:64979612-64979634 GGGTTCGAAGATAGTTAAATAGG - Intergenic
1069210721 10:65756285-65756307 GGTTGCCAAGATCATTCAATGGG - Intergenic
1069852025 10:71413243-71413265 GGGTGCTAAGATCATTCAATGGG - Intronic
1070084206 10:73219631-73219653 GGGTGCCAAGATCATTCAATGGG + Intronic
1070937413 10:80311581-80311603 GGGTGCCAAGAACATTCAATAGG + Intergenic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1072825557 10:98602683-98602705 AAGTGCCAAGATGATTAAATGGG + Intronic
1072837553 10:98732509-98732531 AGGTGCCAAGATAAGTAAATGGG + Intronic
1072940999 10:99763766-99763788 GGATTCCAAGACAATTCAGTGGG + Intergenic
1073171629 10:101514755-101514777 AGATGCCAAGATAATTCAATGGG - Intronic
1073847255 10:107571161-107571183 GGATGCCAAGACAATTCTGTGGG + Intergenic
1074135513 10:110622924-110622946 TGGTGCCAGGATAATTCAATGGG - Intergenic
1074624604 10:115167162-115167184 GGGTGCCAAGACCATTTAATGGG - Intronic
1074641123 10:115381964-115381986 GGGTGCCAAAATAAGTAAATGGG - Intronic
1074844197 10:117382679-117382701 AGGTGCCAAGACATTTAAATGGG - Intergenic
1076385852 10:130054933-130054955 GGGTGCCAAGAATATAAAATGGG + Intergenic
1077403743 11:2372596-2372618 GGGTACCAAGACAATTCAATGGG - Intergenic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1078029114 11:7730891-7730913 GGGTGTCAAGAATATTCAGTGGG - Intergenic
1080079366 11:28196856-28196878 GGGTACCAATATAGTTAAATTGG + Intronic
1080359532 11:31495745-31495767 GGGTGCCAAGACCATTCAATGGG + Intronic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1081366393 11:42240407-42240429 AGGTGCTATGATAATTAAATTGG + Intergenic
1081539440 11:44020017-44020039 GGGTGCCAAGATAATTCAGTGGG - Intergenic
1081624324 11:44639260-44639282 GGATGCCAAGACAATTCAATGGG + Intergenic
1083254776 11:61489396-61489418 GGGTGCAAAGACAAGTAAGAAGG - Intronic
1084152243 11:67293999-67294021 GGGTGACAAGACCATTCAGTGGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084330858 11:68429417-68429439 GGCTGCCAAGAGGAATAAGTGGG + Intronic
1084353485 11:68621000-68621022 GGGTGCCAAGACCGTTCAGTGGG + Intergenic
1084794083 11:71492537-71492559 GGGTGCCAAGATACATCACTGGG - Intronic
1084896919 11:72278739-72278761 GGGTGCCAAGATTATTCAATGGG - Intergenic
1085149856 11:74242242-74242264 AGGTGCCAAGACAATTAAATGGG - Intronic
1085215926 11:74831874-74831896 GGGTGCCAAGACCATTCAGTGGG + Intronic
1085348580 11:75783816-75783838 GGGCACCAAGCCAATTAAGTGGG + Intronic
1085485201 11:76857780-76857802 GGATGCCAAGACAATTCAATAGG - Intergenic
1087209182 11:95428938-95428960 GGATGTCAAGATAATTCAATGGG + Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089357533 11:117864316-117864338 GGGTGCCAAGACCATTCAATGGG + Intronic
1089799296 11:121011708-121011730 GGGTGCCAAGACCATTCAATGGG + Intergenic
1090966747 11:131604819-131604841 GTGTGCCAAGAAAATTCAATGGG - Intronic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1091707662 12:2709727-2709749 GGGTGCCAAGACCATTCAATGGG + Intergenic
1092340560 12:7672415-7672437 AGGTGCCAAGATAATCCAATGGG - Intergenic
1092363631 12:7859063-7859085 GGGTGCCAAGATTATTCAATGGG - Intronic
1092516046 12:9214096-9214118 GGGTGCCAAGAACATTTAATGGG - Intergenic
1093322472 12:17730228-17730250 GAGTGCCAAGATTATTCAATGGG + Intergenic
1093422049 12:18985007-18985029 AGCTGCCAAGACAATTCAGTAGG + Intergenic
1094163055 12:27412116-27412138 GGGTGCCAAGAACACTCAGTGGG - Intronic
1094422608 12:30287340-30287362 AGGTGTCAAGAAAATTAAATGGG - Intergenic
1094645067 12:32315228-32315250 GGGTACAAAGATAATTCAATAGG - Intronic
1095546777 12:43381118-43381140 GGATGCCAAGCTAATTCAATGGG + Intronic
1096279272 12:50237816-50237838 GGGTGCCAAGACCATCCAGTGGG + Intronic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1097132852 12:56825906-56825928 GGGTGCCAAGACCATTCAATGGG - Intergenic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1097633320 12:62091117-62091139 AGGTGCCAAGACAAAAAAGTTGG + Intronic
1097936700 12:65260414-65260436 GGGTGACAAGACAATTCAATTGG - Intergenic
1098039786 12:66342269-66342291 GGGTACCAAGATAATTCAATGGG - Exonic
1098349721 12:69545836-69545858 GGGTGCCAAGACTATTCAATGGG + Intronic
1098934966 12:76468173-76468195 GACTGCCTAGAAAATTAAGTTGG - Intronic
1098945040 12:76580495-76580517 GGGTGCCAAGATAACACAATGGG + Intergenic
1099306326 12:80960465-80960487 GGGTGCCAAGACAGTTCAATGGG - Intronic
1099306351 12:80961061-80961083 GGGTGCCAAGACAGTTCAATGGG - Intronic
1100252420 12:92841190-92841212 GGGTGCCAAGATTATTCAACGGG + Intronic
1100401005 12:94229663-94229685 GGGTGCCAAGACCATTCAATGGG - Intronic
1100424218 12:94468135-94468157 GGGTGCCAAGACCATTCAATGGG + Intergenic
1100684726 12:96974802-96974824 GGGTGCCAAGACCATCAAGTGGG + Intergenic
1101498928 12:105283034-105283056 GGGTGCTAAGATAATTCAATGGG + Intronic
1101927903 12:108988489-108988511 TGGTGCCAAGATCACTCAGTAGG - Intronic
1102069628 12:110006964-110006986 GGGTGCCAAAATAATTCATTGGG - Intronic
1102326160 12:111986479-111986501 GGGTGCCAAGATCATTTAATGGG + Intronic
1102360541 12:112284049-112284071 GGGTCCCAAGATTCTTAAGTTGG - Intronic
1102449689 12:113031993-113032015 GGGTGCCAAGACTATTCAATGGG + Intergenic
1102949099 12:117016898-117016920 TGGTGCCAAGACAATTGAATGGG - Intronic
1103508751 12:121459252-121459274 GGATGCCAAGGCAATTCAGTTGG + Intronic
1104403776 12:128500082-128500104 GAGTGTCAAGACAATTCAGTGGG + Intronic
1104622147 12:130323431-130323453 GTGTGCCAAGACCATTTAGTGGG - Intergenic
1105305024 13:19162150-19162172 TGGTGCCAAGACCATTCAGTGGG + Intergenic
1105903809 13:24783159-24783181 GGGTGCCAAGAACATTCAGTGGG - Intronic
1105906410 13:24814634-24814656 GGGTGCCAAGACCATTCAATGGG - Intronic
1106238863 13:27891265-27891287 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1107257674 13:38448144-38448166 GAGTGCCAAAACAATTCAGTGGG - Intergenic
1107271841 13:38628341-38628363 GTGTGCCAAGATAATTAACTGGG - Intergenic
1107918029 13:45172716-45172738 AGGTGCCAAGAGAATTCAATGGG - Intronic
1108789415 13:53949706-53949728 GGATGCCAAGACAATTTAATGGG - Intergenic
1111294538 13:86261820-86261842 GGGTGCCAAGACCATTTAATGGG - Intergenic
1111730411 13:92069129-92069151 GGATGCCAAGAAAATTCAATAGG - Intronic
1112605982 13:100906542-100906564 GAGTGCCAAGAACATTCAGTGGG + Intergenic
1112702334 13:102024851-102024873 GGGTACCAAGACTATTCAGTGGG - Intronic
1112866271 13:103903947-103903969 GGGTACTAAGATAATTCAATTGG - Intergenic
1112933647 13:104772346-104772368 GGGTGACAATATAATGAAGCAGG + Intergenic
1113002060 13:105651846-105651868 GGGTGGCAAGATCATTTAATGGG + Intergenic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1114180301 14:20361155-20361177 GGGTGCCAAGACCATTCAATGGG + Intergenic
1114275913 14:21144217-21144239 GGGTACCAAGACTATTCAGTGGG - Intergenic
1114562740 14:23604989-23605011 GGTTGTTAAGATAATTATGTGGG + Intergenic
1115176390 14:30566027-30566049 GGGTGCCAAGACCATTAAATGGG - Intronic
1115223083 14:31076661-31076683 GGGGGCCAAGACAATTCATTGGG - Intronic
1115827392 14:37293272-37293294 GGGTGCAAAGATGATTATTTTGG - Intronic
1116142649 14:41018833-41018855 GGCTGCCAAGTTAATTCAATGGG - Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1117354216 14:54907997-54908019 GGATGCCAAGACAATTTAATGGG + Intergenic
1117387260 14:55228245-55228267 GGGTGCCAAGATAATTAACGAGG + Intergenic
1117821568 14:59655698-59655720 GGGTGCCAAGACCATTCAGTGGG + Intronic
1118218948 14:63837171-63837193 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1118225062 14:63890919-63890941 GGGTGCAAAGATGAATAAGCGGG - Intronic
1118298514 14:64592734-64592756 GGGTGCCAAGACAATTCAATGGG + Intergenic
1119477558 14:74939886-74939908 GGCTGCCAATATAGTCAAGTAGG + Intergenic
1119572923 14:75692177-75692199 AGTTGTCAAGATATTTAAGTAGG + Intronic
1120374558 14:83686009-83686031 GGGTGCCAACATAATCAATGAGG + Intergenic
1120784874 14:88524347-88524369 GGGTGCCAAGACCAGTTAGTGGG + Intronic
1120806518 14:88757199-88757221 TGGTGCCAAGACAATTCAATGGG + Intronic
1120832548 14:89010513-89010535 GGGTGCCATGACAATTCACTAGG + Intergenic
1120915321 14:89705345-89705367 TAGTGGCAAGTTAATTAAGTAGG - Intergenic
1121316875 14:92966818-92966840 GGGTGCCAAGACAATTCAAGGGG + Intronic
1121581171 14:95032423-95032445 TGGTGCCAAGATAATTCAATGGG - Intergenic
1122583852 14:102790281-102790303 GGGTGCCAAGACGATTCAATAGG - Intronic
1202901669 14_GL000194v1_random:46947-46969 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1124176554 15:27430664-27430686 GGGTGCCAAGACAACTAATTGGG - Intronic
1124427699 15:29576206-29576228 GGGTGCCAAGTTCATTCAATGGG + Intergenic
1125215374 15:37266974-37266996 GGGTGCCAAGACAATTCAATGGG + Intergenic
1125275638 15:37987630-37987652 GTGTGCCAAGACAATTCACTGGG - Intergenic
1125830445 15:42712582-42712604 GGGTGCCAAGACAATTCAATGGG - Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126570770 15:50147888-50147910 GAGTGCCAAAATCATTCAGTGGG + Intronic
1126735601 15:51729233-51729255 GGGTGCCAAGTTAAGGAATTTGG + Intronic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1127209241 15:56755622-56755644 GTGTGCCAAGACAATTCAATGGG + Intronic
1127218599 15:56851875-56851897 GGATGCCAAGACAATTCAATGGG + Intronic
1127283747 15:57514866-57514888 GGGTGCCAAGACAATTCAATGGG - Intronic
1127738479 15:61871357-61871379 GGATGTCAAGATAATTCAATAGG - Intronic
1127822512 15:62671545-62671567 GGGTTCCAAGACAATTCAGTGGG - Intronic
1128006311 15:64245011-64245033 AGGTGCCAAGAACATTCAGTAGG + Intronic
1128381033 15:67112906-67112928 GGGTGCCAAGACAATTCACTGGG - Intronic
1128663074 15:69517037-69517059 GGGTGCCAAGACCATTCAATGGG - Intergenic
1128899322 15:71405456-71405478 AGGTGCCAAGACAATTCATTAGG - Intronic
1128955915 15:71944615-71944637 AGGCACCAAGATAATTTAGTGGG - Intronic
1130758591 15:86793363-86793385 GAGTTCCAAGATCATTCAGTAGG + Intronic
1131114637 15:89786868-89786890 GGTTGCCAAGACCATTCAGTGGG + Intronic
1132127885 15:99245610-99245632 GCATGCCAAGATAATTCAATGGG + Intronic
1132199178 15:99936943-99936965 GAGTGGCAAGATCATTAAGTAGG - Intergenic
1132259741 15:100412324-100412346 GGGTGCCAAGACCATTCAATGGG - Intronic
1132791834 16:1694708-1694730 GGGTGCCAAGATCATCCAGTGGG + Intronic
1134268718 16:12715061-12715083 GGGCGCCAAGACAATTCAATGGG - Intronic
1134873532 16:17675159-17675181 AGGTGCCAAAATAATTTAATGGG - Intergenic
1135124207 16:19793918-19793940 GGGTGCCAAGACCATTTAATGGG + Intronic
1135127086 16:19819965-19819987 GGGTGCGAAGACCATTCAGTGGG + Intronic
1135198564 16:20416452-20416474 GGGTACCAAGACAATTAAATGGG + Intronic
1135235762 16:20754323-20754345 GTGTGCTAACATAATTAAATAGG + Intronic
1135264165 16:21007963-21007985 TGGTGCCAAGATGATTAAATAGG - Intronic
1135358525 16:21791122-21791144 GGGTGCCCAGTTAACTAACTTGG + Intergenic
1135457027 16:22607247-22607269 GGGTGCCCAGTTAACTAACTTGG + Intergenic
1135542368 16:23341191-23341213 AGGTGCCAAGACAATTAAATGGG + Intronic
1136013622 16:27381273-27381295 GGGTGCCAAGATTACCATGTGGG + Intergenic
1136018299 16:27421074-27421096 GGGTGCCAAAACAATTCAATGGG - Intronic
1136184410 16:28577888-28577910 GGGTGTCAAGACAAATTAGTGGG - Intronic
1136654435 16:31701443-31701465 GGGTGTTAAAATAATTAAATGGG - Intergenic
1137297099 16:47105216-47105238 GGGTGCCAAGACCATTCAATAGG + Intronic
1137341282 16:47608731-47608753 GGGTGCCAAAACAATTCAGTAGG - Intronic
1137730884 16:50688780-50688802 GGATGCCAAGATAATTCAAAGGG - Intergenic
1137730987 16:50690141-50690163 GGATGCCAAGATGATTCAGGGGG - Intergenic
1137880460 16:52040849-52040871 GGGTACCAAGATAACTTAATGGG - Intronic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1138280327 16:55768159-55768181 CGTTGCCAAGACAATTAAGGAGG - Intergenic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1140060005 16:71560612-71560634 GGGTGCCAAGATGACTGAATGGG - Intronic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1141122840 16:81374847-81374869 AGGTGCCAAGGCAATTTAGTGGG + Intronic
1142384576 16:89755106-89755128 GGGTGCCAAGACCATTCAGTGGG + Intronic
1143148727 17:4793759-4793781 GGGTGCCAAGATCATTCAATGGG + Intergenic
1146040989 17:29454186-29454208 GGATGCCAAGACAATTCAATGGG - Intronic
1146139592 17:30353609-30353631 GGGTGCCAAGACCATTCAATGGG - Intergenic
1146147643 17:30435386-30435408 GGATGCCAAGACAATTCAATAGG + Intronic
1146600243 17:34208260-34208282 GGGTGCCAAGATAATTCAATGGG - Intergenic
1146964426 17:37012729-37012751 GGGTGCCAAGACAGCTCAGTGGG + Intronic
1148286124 17:46394009-46394031 GGGCGCCAAGATCATTAACTGGG + Intergenic
1148308291 17:46611599-46611621 GGGCGCCAAGATCATTAACTGGG + Intronic
1150268625 17:63848024-63848046 GGATGCCAAGATAATGTAGCAGG + Intergenic
1150817541 17:68404948-68404970 GGGTGCCAAGACCATTCAATGGG - Intronic
1150828536 17:68497961-68497983 GGGTGCCAAACTACTTAAGATGG + Intergenic
1150921092 17:69483821-69483843 GAGTGCCAAGACAATTCAGGGGG + Intronic
1152582883 17:81175662-81175684 GGGTGCCAAGACCATTCAATGGG + Intergenic
1152692087 17:81723116-81723138 GGATGCCAAGACAATTCAGTGGG + Intergenic
1152972878 18:181983-182005 AGGTGCTAAGACAATTCAGTGGG - Intronic
1153333483 18:3898367-3898389 GGCTGCTGTGATAATTAAGTGGG - Intronic
1153391537 18:4567061-4567083 GGGTGCCAAAATTATTCATTGGG + Intergenic
1153548014 18:6229739-6229761 GGGAGCCAAGACTATTCAGTGGG - Intronic
1153825725 18:8872676-8872698 GGGTGCCTAGATAACTCAATGGG - Intergenic
1153831405 18:8926754-8926776 GGGTGCCAGGATCATTAAATGGG + Intergenic
1153845392 18:9044825-9044847 AGGTGCCAAGATTATTCAGTGGG + Intergenic
1153873690 18:9345524-9345546 GGGTGGCAATATAACTCAGTGGG - Intronic
1154330362 18:13424512-13424534 GGATGCAAAGATAATGACGTGGG + Intronic
1155221260 18:23688321-23688343 GGGTGCCAAGACTATTCAATGGG - Intergenic
1155856168 18:30837740-30837762 GGGTGCCAAGAATATAAAATGGG - Intergenic
1156293257 18:35768439-35768461 TGGTGCCAAGAAAATTCAATGGG - Intergenic
1157093221 18:44660951-44660973 GGGTTTCAAGATAATGATGTTGG + Intergenic
1157637457 18:49173084-49173106 GGGTGCCAAGGTAATTTAAGGGG - Intronic
1157961818 18:52162673-52162695 GGGTACCAAGTTAATTCAATGGG - Intergenic
1158951750 18:62501555-62501577 GGGTGCCAAGACAATAAAATGGG + Intergenic
1159701062 18:71628301-71628323 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1160640401 19:127290-127312 GGGAGCCAACATTATTCAGTGGG + Intergenic
1161749694 19:6086196-6086218 GGGTGCCAAGATCATTCGATGGG - Intronic
1162228453 19:9244425-9244447 GGGTGCCAAGAACATTCATTGGG + Intergenic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1163056457 19:14723187-14723209 GGGTGCCAAGACCATTCAATGGG - Intronic
1163383440 19:16984077-16984099 GGGTGCCAAGACCATTCAATGGG + Intronic
1163539870 19:17901693-17901715 GGATGCCAAGACCATTAAATGGG - Intergenic
1163825634 19:19522892-19522914 AGGTGCCAAGATAATTCAATGGG - Intronic
1165191953 19:34071661-34071683 GGGTGCCAAGACCATTCAATGGG + Intergenic
1165597073 19:37018470-37018492 GGGTGCCAAGATCAGTCAATGGG + Intronic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1165764170 19:38340172-38340194 AGGTGCCAAGACAATTCAGCGGG - Intronic
1165876370 19:39010372-39010394 CGGTGCCAAGACCATTCAGTGGG - Intronic
1165989180 19:39796791-39796813 GGTTGCCAAGATTACTCAGTGGG - Intergenic
1166405280 19:42517057-42517079 GGGTGCCAAGATCATTCAGTGGG + Intronic
1166417161 19:42604160-42604182 GAGTGTCAAGATAATTTAATGGG - Intronic
1166463602 19:43013004-43013026 GTGTGCCAAGATCATTCAATGGG + Intronic
1166469753 19:43069581-43069603 GTGTGCCAAGATCATTCAATGGG + Intronic
1166969364 19:46553801-46553823 GAGTGCCAAGATCATTTAATGGG - Intronic
925562839 2:5216754-5216776 GTGTAAGAAGATAATTAAGTGGG + Intergenic
926813640 2:16779056-16779078 AGGTGCCAAGATAATGTAGCTGG + Intergenic
926835705 2:17017508-17017530 ATATGCCAAGATAATTCAGTAGG - Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927953264 2:27188890-27188912 GGGTGCCAAGACAATTGAATGGG + Intergenic
927984418 2:27398232-27398254 TGATGCCAAGATAATTCAATGGG + Intronic
928050068 2:27983236-27983258 GGGTGCCAACACAATTCAATGGG - Intronic
928151462 2:28833593-28833615 GGGTGCCAAGAAAATTCAATGGG + Intronic
928589282 2:32797495-32797517 GGGTGCCAAGACTATTCAATGGG + Intronic
928698590 2:33875908-33875930 GGGTGCCAAGATAATTCAGTGGG - Intergenic
929384746 2:41392868-41392890 GGGTGCCAAGATCATTCAAGGGG - Intergenic
929616191 2:43310466-43310488 GGGTGCCATGACAATTCAATGGG + Intronic
929819495 2:45261888-45261910 TTGTGACAATATAATTAAGTGGG - Intergenic
930496542 2:52152088-52152110 GGGTGCCAAGATCATACAGTGGG + Intergenic
930893244 2:56415521-56415543 GGGTACAAAGATAATTTATTAGG - Intergenic
930998862 2:57757411-57757433 GGGTTCCAATATTATAAAGTGGG + Intergenic
931522612 2:63116064-63116086 GGGTGCCAAGACCATTAAATGGG - Intergenic
931523847 2:63130377-63130399 GGGTGCCAAGACCATTTAATGGG - Intronic
931896676 2:66739397-66739419 GGGTGCCAAGACAATTCAATGGG - Intergenic
932061763 2:68508337-68508359 AGGTGTCAAGACAATTAAATGGG + Intronic
932085942 2:68761114-68761136 GGGTGCCACGATAATTTAATGGG + Intronic
932170110 2:69547026-69547048 GGGTGCCAAGACAATTCAATGGG + Intronic
932499049 2:72165288-72165310 GGATGCCAAGACCATTCAGTGGG + Intergenic
932557501 2:72838002-72838024 GAGTGACAAGATAATTCAATAGG - Intergenic
932630299 2:73336230-73336252 GGCTACCAAGATAATTCAATGGG + Intergenic
932653325 2:73583745-73583767 GGGTGCCAAGACCACTCAGTGGG - Intronic
932882918 2:75520572-75520594 GGGTGCCAAGACCATTCAATGGG + Intronic
933207611 2:79526701-79526723 GGGTGACAAGACAATTTAATGGG + Intronic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933855451 2:86409547-86409569 GAGTGCCAAGATCATTTAATGGG + Intergenic
933920175 2:87038027-87038049 GGGTGCCAAGACAATTCAACAGG + Intergenic
933931449 2:87155759-87155781 GGGTGCCAAGACAATTCAACAGG - Intergenic
934002823 2:87731866-87731888 GGGTGCCAAGACAATTCAACAGG - Intergenic
934505095 2:94884163-94884185 GGGTGCCAAGATTATTCAGTGGG - Intergenic
934726727 2:96625786-96625808 GGGAGGCTAGAAAATTAAGTGGG + Intronic
934776669 2:96942873-96942895 GGGTGCCAACAGAATTCAATAGG + Intronic
934878237 2:97947907-97947929 GGGTGCCAAGGCAATTCAATTGG + Intronic
935052774 2:99537529-99537551 GGGTGCCAAGAAAATTCAATGGG + Intergenic
935521049 2:104105594-104105616 GGATGCCAAGAGTATTAAGTAGG + Intergenic
935728855 2:106048026-106048048 AGGTGCCAAGATAATTTAGTGGG - Intergenic
935741839 2:106155789-106155811 GGGTGCCAGGAAAATTCAATGGG + Intronic
935805167 2:106738838-106738860 GGATGCCAAGACAATTTAATGGG - Intergenic
936361671 2:111809680-111809702 GGGTGCCAAGACAATTCAACAGG + Intronic
936663610 2:114569696-114569718 GGGTGGCAGGATAAAGAAGTGGG + Intronic
937716973 2:125043338-125043360 GGGAACCATGACAATTAAGTGGG + Intergenic
937749949 2:125463581-125463603 ATGTGCCAAGATAAATAAATGGG + Intergenic
938136237 2:128759332-128759354 GAGTACCAAGATCATTCAGTGGG - Intergenic
938188816 2:129256007-129256029 GGGTGCCTAGATGAGTAAGTGGG - Intergenic
938188855 2:129256250-129256272 AGGTGCCTAGATGAGTAAGTAGG - Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938844285 2:135192757-135192779 GGGTGCCAAGATCATTCAATGGG + Intronic
938898233 2:135774233-135774255 GGGTACCAAGACTATTCAGTGGG + Intronic
939195857 2:138970737-138970759 GGGTGCCAAGTCCATTCAGTGGG - Intergenic
939368982 2:141273455-141273477 GGGTGCCAAGAAAGTTCAATGGG + Intronic
940942078 2:159573389-159573411 GGGTGCCAAAACAATTCAATGGG + Intronic
941488150 2:166107685-166107707 GGGTGCTAACATAATTTAATTGG + Intronic
941846191 2:170136046-170136068 AGGTGCCAAGAACATTTAGTGGG + Intergenic
942056327 2:172186920-172186942 GGGTGCCAAGACTATTTAATGGG - Intergenic
942180530 2:173376412-173376434 GGGTGCCAAGAGCATTCAATGGG - Intergenic
942622476 2:177861793-177861815 GGGTGGCAAGACAAATAAATTGG + Intronic
943550619 2:189334950-189334972 AGGTGTCAAGATAATTTAATAGG + Intergenic
944009138 2:194951895-194951917 GAGTGCCAAGATAATGAAATGGG + Intergenic
944418465 2:199502823-199502845 GGGTGCCAAGACAACTCAATGGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
944722540 2:202438727-202438749 GGGTGCCAAGACAATTCAATGGG - Intronic
945052805 2:205841501-205841523 GGGTACCAAGACAATAAAATGGG + Intergenic
945108451 2:206339908-206339930 GGATGCCAAGATCATTCAATGGG - Intergenic
945237805 2:207648485-207648507 AGGTGCCAAGAGAATTCAATGGG + Intergenic
945843852 2:214919603-214919625 GGGTGCCAAGTCCATTCAGTGGG + Intergenic
946184233 2:217969200-217969222 TGATGCCAAGATCATTCAGTGGG + Intronic
946564363 2:220946761-220946783 GGGTGCAAAGACAAATAATTAGG + Intergenic
947071900 2:226297601-226297623 GGGTGCCAAGACAAGTCAATAGG + Intergenic
947911799 2:233805793-233805815 GGGTGCCAAGACAATTCAGTGGG + Intronic
948331814 2:237173981-237174003 GGGTACCAAGATGATTCAATGGG - Intergenic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
948914149 2:241022491-241022513 GGGTGCCAAGGTTATTCAGTGGG - Intronic
948985023 2:241516222-241516244 GTATGCCAAGACAATTCAGTTGG + Intergenic
1168732907 20:103099-103121 GGGTGTCCAGACAATTCAGTGGG - Intergenic
1169038646 20:2474659-2474681 GGGTGCCAAGATTATTCAGTGGG - Intronic
1169164640 20:3411874-3411896 GGGTACCAAGACAATTCAATGGG - Intergenic
1169237147 20:3939461-3939483 GGGTGCCAAGACAATTCAGTGGG - Intronic
1169238713 20:3955396-3955418 GGGTGCCAAGATCATTCAATGGG - Intronic
1169396235 20:5232472-5232494 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1169523583 20:6399465-6399487 GGATGCAAAGATAATTAAACTGG + Intergenic
1169949272 20:11025195-11025217 GGGTGCCAAGACAATTCAATAGG - Intergenic
1170235228 20:14096105-14096127 GTGTGCCAATATAATTTACTAGG - Intronic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1170563873 20:17582577-17582599 GAGTGCCAGGATAATTCAGTTGG + Intronic
1170637872 20:18124333-18124355 GGGTGCTAAGATCATTCAATTGG + Intergenic
1170909833 20:20555187-20555209 GGGTGCAAAGACAATTCAGTCGG - Intronic
1171049882 20:21847402-21847424 GGGTGCCAAGACCATTTAGTGGG + Intergenic
1171281568 20:23903750-23903772 GGGTACCAAGATTATTATGTGGG + Intergenic
1171892762 20:30730928-30730950 GGGTGCCAAGATTATTCAGTGGG - Intergenic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173560243 20:43999939-43999961 GGGTGTCAAGACCATTCAGTGGG + Intronic
1174237832 20:49108592-49108614 GGGTGCCAAGACCATTCAATGGG + Intergenic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1175629512 20:60522996-60523018 GGGAGCCAAGATCATTCAATGGG + Intergenic
1176621041 21:9061721-9061743 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1180191172 21:46163611-46163633 GAGTGCCAAGACAATTCAGGAGG - Intronic
1180895057 22:19325052-19325074 GGGTGCCAAGACCATTCAATGGG + Intergenic
1182340121 22:29613666-29613688 GGGTGCAAAGACCATTCAGTGGG + Intronic
1182497132 22:30717373-30717395 GGATGCCAAGATGACTCAGTGGG - Intronic
1182507926 22:30798688-30798710 GTGTGCCAAGACCATTCAGTAGG - Intronic
1182513270 22:30835396-30835418 GGGTGCTAAGATAATTAAATGGG - Intronic
1182668895 22:31979383-31979405 GGGTGCCAAAAAAATTCAATGGG - Intergenic
1182817860 22:33182453-33182475 GGATGCCAAGACAATTCAATAGG + Intronic
1184013677 22:41769289-41769311 GGATGCCAAGATAATTCAATGGG + Intronic
1184439907 22:44503725-44503747 GGGTGCCAAGACAGTTCAATGGG + Intergenic
1184905132 22:47477858-47477880 GGGTGCCAAGACAATTCAGTGGG - Intronic
1185209472 22:49561618-49561640 GTGTGCCCAGATCATGAAGTGGG + Intronic
1185239089 22:49732170-49732192 GGGTGCCAAGACCATTCAATAGG - Intergenic
1185252010 22:49807489-49807511 GGGTGCCAAGACCATTCAGAGGG + Intronic
1185412327 22:50690082-50690104 GGGTGCCAAGACCATTCAATGGG - Intergenic
950048539 3:9967476-9967498 GGGTACCAAGACTATTCAGTGGG - Intronic
950208742 3:11101180-11101202 GGGAGCCAAGAAAATTCAATGGG - Intergenic
950735002 3:14999769-14999791 AGGTGCCACGATAATTCAATAGG - Intronic
950955578 3:17050057-17050079 GGGTGTCAAGATTATACAGTGGG + Intronic
950973807 3:17218117-17218139 GGGTGCCAAGATTATTTATGTGG - Intronic
951616613 3:24553696-24553718 GGGTGCCATGATAATTCAATGGG - Intergenic
951719546 3:25683392-25683414 GGGTGCCAAGATCATTCAATAGG + Intergenic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
952786327 3:37159251-37159273 GGGTGGCAAGGTAATTCAGTGGG - Intronic
953313607 3:41905205-41905227 GGGTTCCAAGACAATTCAATGGG + Intronic
954287929 3:49632051-49632073 GAGTGCCAAGACCATTCAGTAGG + Intronic
954475841 3:50744841-50744863 GGGTGCCAAGACCATTAAATGGG - Intronic
954584676 3:51722796-51722818 GGGTGCCAATATAATGCAGTGGG - Intergenic
954721164 3:52564783-52564805 GGGTTCCAAGACAATTCATTGGG + Intronic
955304103 3:57812336-57812358 GGGTGCCAAGATCATTTAATGGG - Intronic
955946744 3:64201998-64202020 GGGTACCAAGACAATTCAATGGG - Intronic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
958807364 3:98827952-98827974 GGGTGCCTAGACAATTCAATGGG + Intronic
959004067 3:100999337-100999359 GGGTGCAAAATTAATTCAGTGGG - Intergenic
959977500 3:112477886-112477908 GGGTACCAAGATTATTCAGTGGG - Intronic
960077819 3:113508008-113508030 GGGTGCCAAGACAATTCAACGGG + Intronic
960646906 3:119895673-119895695 GGATTCCAAGATAATTCAATGGG - Intronic
960881031 3:122345131-122345153 GGGTGCCAAGATAATTCGATGGG - Intergenic
961387730 3:126532534-126532556 GGGAGCCAAGACAATTCAATGGG - Intronic
961401483 3:126648570-126648592 GGGTGCCAAGACCATTCAATGGG + Intronic
961409671 3:126710209-126710231 AGGTTCCAAGATAATTCAATGGG - Intronic
961411347 3:126723068-126723090 GGGTGCCAAGATGGTTCAGTGGG - Intronic
961605165 3:128088283-128088305 GATTACCAAGATAAATAAGTTGG - Intronic
961710055 3:128821213-128821235 GGGTGCCAAGACCATTCAATGGG + Intergenic
962433331 3:135341127-135341149 GAGTACCAAGATAATTCAATGGG + Intergenic
962934112 3:140063718-140063740 GGGTGACAAGATACTGAAGGAGG - Intronic
963180036 3:142345252-142345274 GGGTGCCAAGACTATTCAATGGG + Intronic
963180040 3:142345273-142345295 GGGTGTCAAGAAAATTCAATGGG + Intronic
963731954 3:148983254-148983276 TCGTGCCAAGACAATTCAGTGGG + Intergenic
963879849 3:150516775-150516797 GGGGGCCAAGACAATTCAATGGG + Intergenic
964253234 3:154744699-154744721 GGGTGCCAAGACAACTGAATGGG + Intergenic
964671682 3:159233186-159233208 ATGTTCCAAGAGAATTAAGTCGG + Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
964788196 3:160422912-160422934 GGATGCCAAGAAAATTCAATGGG - Intronic
965738500 3:171848039-171848061 TGGTGACAAGATGATTAATTTGG - Intronic
965896349 3:173581939-173581961 GGGTGCCAAGTAAATGAAATTGG - Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
966707684 3:182934404-182934426 AGGTACCAAGATAATTAAGTGGG + Intergenic
966799684 3:183751211-183751233 GGGTCCCAAGACCATTCAGTGGG - Intronic
967004087 3:185367192-185367214 GGGTGCCAAGACAATTTAATGGG - Intronic
967619604 3:191617088-191617110 GGGTGCCAAGACAGTTCAATAGG + Intergenic
967906265 3:194503046-194503068 GGGTGCCAAGACAATTCAATGGG + Intergenic
968580339 4:1387706-1387728 TGGTGCGAAGATAATTCAATGGG - Exonic
968715021 4:2150713-2150735 AGGCGCCAAGGTAATTAAATGGG + Intronic
970058583 4:12003416-12003438 GGGATCCAAGATCATTTAGTGGG + Intergenic
970640579 4:18061200-18061222 GGGTGCCAAGACTATTGAATGGG - Intergenic
971023157 4:22559069-22559091 GGGTGCCAAGACAATTCAATGGG - Intergenic
971868304 4:32202271-32202293 GGGTGCCAAGAGAATTGAGTAGG - Intergenic
971880042 4:32359768-32359790 GGATGCCAAGAACATGAAGTGGG - Intergenic
972127455 4:35787562-35787584 GGGTGCCAAGACAATACAATGGG + Intergenic
972551434 4:40138668-40138690 GAGTGCCAAGAAAATTCAATGGG - Intronic
972626407 4:40803825-40803847 GGGTGCCAAGACCATTCAATAGG - Intronic
973315319 4:48753896-48753918 GGGCACCAAGACAATTCAGTGGG - Intronic
973911740 4:55588747-55588769 GAGTGCCAAGACCATTAAATGGG - Intronic
974360943 4:60878287-60878309 GGGTTCCAAAATAATTAAAAGGG + Intergenic
974846481 4:67357207-67357229 GGGTGTCAACACAATTAAATGGG - Intergenic
975391646 4:73825049-73825071 GGGTGCCAAGATAAATAAATGGG - Intergenic
975575811 4:75861392-75861414 GGGTCCCAAGATCATTTAATGGG + Intronic
975636465 4:76454424-76454446 GAGTGCCAAGATCATTCAGTAGG - Intronic
975641820 4:76508320-76508342 GGGAACCAAGAAAATTAAATGGG - Intronic
975960970 4:79904681-79904703 GGTTGCAAAAACAATTAAGTGGG - Intronic
977468816 4:97415775-97415797 GGGTGCCAAGAAAATTCAATGGG - Intronic
977664302 4:99627434-99627456 GGATGCCAAAATAATTCAATGGG - Intergenic
978780244 4:112544864-112544886 GGGTTCCAAGACAATTACATGGG + Intronic
979223064 4:118251556-118251578 GGCTGCCAAGGTAAGTCAGTGGG - Intronic
979590070 4:122468402-122468424 GGGTGCCAAGACAATTCAGTGGG + Intergenic
980821222 4:138020181-138020203 GGGTGCCAAGACAATTCAATGGG + Intergenic
981084019 4:140664694-140664716 GGGTGCTAAGACAATTCACTGGG + Intronic
981963500 4:150572464-150572486 TTCTGCAAAGATAATTAAGTTGG - Intronic
982034083 4:151328230-151328252 GGGTGCCAACATAATTCAACAGG + Intergenic
982935547 4:161470359-161470381 GGGTGCCAAGACCATTCAGTGGG - Intronic
983655281 4:170076974-170076996 GGGTGCCAAGATCATTCAGTGGG - Intronic
983827268 4:172278942-172278964 GGGTGCCAAGAGTATTCAGTGGG + Intronic
983902778 4:173154214-173154236 GGGTAAAAAGATGATTAAGTAGG + Intergenic
985298626 4:188462713-188462735 GGGTGCCAAGAATATTCAATAGG + Intergenic
985483630 5:136045-136067 GGGTGCCAAGACTATTCACTGGG + Intergenic
986935462 5:12879011-12879033 GGGTGCCAAGACCATTCACTAGG - Intergenic
987184562 5:15402461-15402483 GGGTGCCAATATCATTCAATGGG + Intergenic
988801970 5:34704490-34704512 GGGTTTAAAGATAGTTAAGTAGG - Intronic
988830839 5:34985744-34985766 GGGTGCCAAGACCATTCAATGGG - Intergenic
989371970 5:40720313-40720335 GGGTGTCAAGACAATTTAATGGG - Intronic
989416851 5:41188499-41188521 GGGTGCCAAGACAGTTCAATGGG + Intronic
989819801 5:45782714-45782736 AGCTGCCAAGATAATTTAATTGG - Intergenic
990275309 5:54189520-54189542 GGGTGAAAAGATCATTCAGTGGG + Intronic
990859289 5:60308756-60308778 GGGTTCCAAGATAATTCAGATGG + Intronic
991908229 5:71534349-71534371 GGGTGCCAAGACTATTCAATGGG - Intronic
992598553 5:78371424-78371446 GTGTGCCAAGATCATTCAATGGG - Intronic
992650678 5:78856163-78856185 GGGTGCCAAGATAGTTCCATTGG - Intronic
992983013 5:82196654-82196676 GGGTGCCAAGATAATTAAGTGGG - Intronic
993484803 5:88470303-88470325 AGGTGCAAAGAAAATTAAATAGG - Intergenic
994036297 5:95205216-95205238 AGGTGCCAAGAAAATAAAATGGG + Intronic
994067577 5:95560571-95560593 GGGTGCCAAGACCATTTAATAGG + Intronic
994221475 5:97200668-97200690 GGATTCCAAGAAAATTCAGTTGG + Intergenic
994654627 5:102575684-102575706 GGGTGCCAAGACAATTCAATGGG - Intergenic
995489250 5:112673054-112673076 GGGTGCCATGACCATTCAGTGGG - Intergenic
995636243 5:114194956-114194978 TGGTGCCAAGACAATTGAATGGG - Intergenic
995636297 5:114196057-114196079 GGGTGCCAAGACAATTGAATTGG - Intergenic
995649333 5:114350721-114350743 GGGTGCCTAGATAATTCATTGGG - Intergenic
995994030 5:118278015-118278037 TGGTGCAAAGATAATTATATGGG + Intergenic
996802977 5:127424137-127424159 GGGTATCAAGACAATTCAGTGGG - Intronic
997971887 5:138410411-138410433 AGGTGCCAAGGTAGTTCAGTGGG + Intronic
998410446 5:141906563-141906585 GGGTGCCAAGAGCATTCAATGGG + Intergenic
998943690 5:147313796-147313818 GGGTGCCAAGAAAATTCAATGGG + Intronic
999184498 5:149696309-149696331 GGGTGCCAAGACCATTCAATGGG + Intergenic
999442065 5:151609575-151609597 GGATGCCAAGACAATTCAATGGG - Intergenic
1000566975 5:162860546-162860568 AGGTGCCGAGACAATTTAGTAGG + Intergenic
1001248789 5:170128351-170128373 GGGTGCCCAGATCATTCAATGGG + Intergenic
1001393333 5:171398452-171398474 GGTTGCCAAGATCATTCAATGGG - Intronic
1002543588 5:179923306-179923328 AGGTGCCAAGACAGTTCAGTGGG - Intronic
1002736949 5:181399125-181399147 GGGAGCCAACATTATTCAGTGGG - Intergenic
1002747750 6:75693-75715 GGGAGCCAACATTATTCAGTGGG + Intergenic
1002798026 6:491888-491910 GGGTGCCAAGACCACTCAGTGGG + Intronic
1003597268 6:7485388-7485410 GAGTGCCAAGATCATTCAGTGGG - Intergenic
1004470022 6:15920813-15920835 GGGAGACAAGAAAATAAAGTGGG - Intergenic
1004745450 6:18504517-18504539 TGGTACGAAGATAACTAAGTTGG - Intergenic
1005241158 6:23829425-23829447 GGGTTCTAAGATAATTCACTGGG - Intergenic
1005272605 6:24182039-24182061 GGGTGCCAACACCATTCAGTAGG + Intronic
1005523421 6:26621541-26621563 GGGTGGCAAGAGAATTCAATGGG - Intergenic
1006209238 6:32379842-32379864 GGGTGCCAAGACCATTCAATGGG + Intergenic
1006649614 6:35540235-35540257 GTGTGCCAAAAGAATGAAGTTGG - Intergenic
1006659508 6:35628249-35628271 GGGTGCCAAGACCATTCAGTGGG - Intronic
1007111307 6:39314714-39314736 GGGCCCCAAGACAATAAAGTTGG - Intronic
1007133393 6:39497891-39497913 AGTTTCCAAAATAATTAAGTTGG - Intronic
1007314174 6:40971295-40971317 GGGTGCTAAGAAAATTCAATGGG + Intergenic
1007592360 6:43030068-43030090 GGATGACAAGATCATTTAGTGGG + Intronic
1007662111 6:43493049-43493071 GGGTTCCAAGGGAATTAAGGTGG + Intronic
1007822922 6:44574644-44574666 GGATGCCAAGACCATTCAGTGGG + Intergenic
1007854735 6:44844122-44844144 AGGTGCCAAGATAACTCAATAGG + Intronic
1007899936 6:45401585-45401607 GGCTGCCATGAGAATTAAATTGG + Intronic
1008286668 6:49661176-49661198 GGGTGCCAAGACCATTTAATGGG + Intergenic
1008637481 6:53425418-53425440 GGGTGCCAAGATCACTCAGTGGG + Intergenic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1009335014 6:62476613-62476635 GGGTGTCAAGACAATTTAATGGG + Intergenic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1012363253 6:98409023-98409045 GGGTGTTAAGAACATTAAGTTGG - Intergenic
1013544790 6:111145460-111145482 GCAAGCCAAGACAATTAAGTGGG + Intronic
1013875095 6:114815847-114815869 GGGTGCCAAGATCATTCAATGGG - Intergenic
1014858001 6:126426610-126426632 TGATGCCAAGATAATTCAGTGGG + Intergenic
1016219077 6:141644589-141644611 GGGTGCCAAGACAACTCAGTGGG + Intergenic
1016398592 6:143653593-143653615 GGATGCCAAGACAATTCAATGGG + Intronic
1016421444 6:143888167-143888189 TGGTGCCAAGATTATTCAATGGG - Intronic
1016436048 6:144038554-144038576 GGATGCCAAGACAATTCAATGGG + Intronic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1017583320 6:155891610-155891632 GAATGCCAAGATAATTCAATAGG + Intergenic
1017897855 6:158696899-158696921 GGGTGCTAAGACCATTCAGTAGG + Intronic
1019087724 6:169497149-169497171 GGGTGCCAAGACCATTAAATGGG + Intronic
1019242046 6:170674659-170674681 GGGAGCCAACATTATTCAGTGGG - Intergenic
1019336939 7:489637-489659 GGGTGTCAAGACTATTCAGTGGG + Intergenic
1019456752 7:1131946-1131968 GAGTGCCATGACAATTCAGTGGG + Intronic
1020871489 7:13635618-13635640 AGGTGCCATGATAATTATATGGG + Intergenic
1021196238 7:17677632-17677654 GGCTTCCATGATAAATAAGTTGG + Intergenic
1021281182 7:18719907-18719929 AGGTGCCAAGACAATTCAGCAGG - Intronic
1022387111 7:29911658-29911680 GGGTGCCAAGACCATTCAATAGG + Intronic
1022661586 7:32372367-32372389 GGGTACCAAGACAATTCAATGGG + Intergenic
1023392462 7:39723379-39723401 GGGTGCCAAAATAATTCAAAAGG + Intergenic
1023693640 7:42822169-42822191 GGGTGCCAAGAACACAAAGTGGG + Intergenic
1024014716 7:45302474-45302496 GGGTGCCAAGACCATTCAATGGG + Intergenic
1024039438 7:45539974-45539996 GGGTGTCAAGGTAGTTCAGTAGG + Intergenic
1024085939 7:45891591-45891613 GGGTGCCAAAAGTATTCAGTAGG + Intronic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1024487984 7:49941986-49942008 GGATGCCAAGATCATTCAATGGG + Intronic
1024952166 7:54875553-54875575 GGATGCCAAGACAATTAAGTGGG - Intergenic
1026586894 7:71662967-71662989 GGGTGTCAAGACAATTCAGTGGG - Intronic
1026681346 7:72469332-72469354 GGGTGCCAAGACCATGAAATAGG - Intergenic
1027511199 7:79082486-79082508 GAATGCCAAGATAATTCAATGGG - Intronic
1027820647 7:83039474-83039496 GAGTGCCAAGAATATTCAGTAGG - Intronic
1027835996 7:83243474-83243496 GGGTGTCAAGACCATTCAGTGGG - Intergenic
1028193870 7:87882207-87882229 GGGTGCCAAGACCATTCATTGGG + Intronic
1028254795 7:88581064-88581086 GGGTGCCAAGAATATACAGTGGG - Intergenic
1029340292 7:99937430-99937452 GAGTGTCAAGACAATTCAGTCGG - Intergenic
1031091082 7:117355447-117355469 GGGTGCCAAGACAATTCAATGGG + Intergenic
1031438343 7:121761036-121761058 GGGTGCCAAGACCATTCAATGGG + Intergenic
1031559230 7:123217564-123217586 GGGGGCCAAGACAATTCAATGGG + Intergenic
1031862800 7:127001140-127001162 AAGTGCCAAGATAATTTAATAGG + Intronic
1031930598 7:127681749-127681771 GGGTGCCAGGATAATTTGATGGG - Intronic
1032232951 7:130092033-130092055 GGGTGACAAGACTATTCAGTGGG - Intronic
1032276250 7:130458300-130458322 GGGTGCCAAGACAATTCACTAGG - Intergenic
1034209490 7:149350558-149350580 GGGTGCCAGGACCATTCAGTGGG + Intergenic
1035052536 7:156008182-156008204 GGGTCCCAAGAAAATTCAATGGG - Intergenic
1035144903 7:156805097-156805119 AGGTGCCAAGGGAATTTAGTGGG - Intronic
1035150360 7:156865804-156865826 GAGTATCAAGATAATTCAGTTGG + Intronic
1035506071 8:133442-133464 GGGAGCCAACATTATTCAGTGGG + Intergenic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1036554453 8:9846373-9846395 GAGTGCCAAGACAATTCAGTGGG + Intergenic
1036574054 8:10008486-10008508 GGGTGCCAAGACCACTCAGTGGG - Intergenic
1036729769 8:11252153-11252175 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1037010213 8:13832596-13832618 GGATGCCAAGACAATTAAATGGG - Intergenic
1038006799 8:23437394-23437416 GGGTTCCGAGATAATTAGTTAGG + Intronic
1038357632 8:26844605-26844627 GGGTGCCAAGACCACTCAGTGGG + Intronic
1038549117 8:28450194-28450216 GGGTGTCAAGACTATTCAGTGGG + Intronic
1038815081 8:30894585-30894607 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1038829266 8:31038840-31038862 GGGTGCCAAGTCCATTCAGTGGG - Intronic
1039163730 8:34652272-34652294 AGGTGCCAAGATTATTGAATGGG + Intergenic
1039651438 8:39343742-39343764 AATTGCCAAGACAATTAAGTGGG - Intergenic
1039732318 8:40293357-40293379 GGGAGCAAAGATACTCAAGTTGG - Intergenic
1039805804 8:40996847-40996869 GGATGCTAAGATAATTCAGCGGG - Intergenic
1040036752 8:42877541-42877563 GGGTGCCAAGACCATTCAATAGG + Intronic
1040643864 8:49375443-49375465 GGATGCCAAGATAATTCAATGGG + Intergenic
1040938633 8:52809293-52809315 GGGTGCCAAGACCATTCAATGGG - Intergenic
1041033941 8:53767691-53767713 GGATGCCAAGATAATTCAATAGG + Intronic
1041553697 8:59129057-59129079 AGATGCCAAGGTAATTCAGTGGG + Intergenic
1042805707 8:72768827-72768849 GGGTGCCAAGACAATTTAATGGG - Intronic
1043751288 8:83938832-83938854 GGATGCCAAGATAATTCAATGGG - Intergenic
1044185596 8:89247146-89247168 TGGTGCCAAGAACATTAACTGGG - Intergenic
1044594535 8:93945644-93945666 GGGTGCCAAGACAATTCAGTTGG + Intergenic
1045072558 8:98524120-98524142 GGATGCCAAGACCATTCAGTGGG - Intronic
1045221228 8:100202385-100202407 GGGTGCCAAGTCTATTCAGTAGG - Intronic
1045239893 8:100390942-100390964 GGGTGCCATGACAATTCACTGGG + Intronic
1045672234 8:104568147-104568169 GGGTGCCAGGAGGATTAAATGGG + Intronic
1045996369 8:108366885-108366907 GGGAGACAAGACAATTAAATGGG + Intronic
1046776601 8:118170556-118170578 GGATGCCAAGACAATTTAATGGG + Intergenic
1047676008 8:127202975-127202997 AGGTGCCAAGGCAATTGAGTAGG + Intergenic
1047914771 8:129570689-129570711 GGGTGTCAAGAAAACTAAATGGG + Intergenic
1049158695 8:141083517-141083539 GGGTGTCAAGACAATTCAGTTGG - Intergenic
1049848067 8:144814059-144814081 AGGTGCCAAGAACATTAACTGGG + Intergenic
1050426881 9:5520315-5520337 GGGTGCCAAGACAGTTCAATAGG + Intronic
1050698247 9:8303846-8303868 AGGTGCCAAGACCATTCAGTGGG - Intergenic
1051803733 9:20966780-20966802 GGGTGCCAAGATCCTTCAATGGG - Intronic
1051966901 9:22839228-22839250 AGGTGCAAAGGTAATTCAGTGGG - Intergenic
1052004788 9:23333659-23333681 GGGTGCCAAGACAATTCAATAGG + Intergenic
1052307554 9:27028062-27028084 GGGTGCTAAGGTAATTAAATGGG - Intronic
1053322211 9:37109163-37109185 GGGTGCCAAGAACATTCAATAGG + Intergenic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1054356120 9:64065243-64065265 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1055555952 9:77473886-77473908 AGGTGCCAAGCTAATTCAATGGG + Intronic
1056378792 9:86038661-86038683 AGGTGCCAAGACAATTCAGTGGG + Intronic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1057187950 9:93068434-93068456 GGGTACCAAGACAATTCAATGGG - Intronic
1057456136 9:95213530-95213552 GGGTGCCAAGATCATTCAATGGG + Intronic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057984320 9:99695414-99695436 AGGTGCCAAGGTAAATAACTGGG + Intergenic
1058067979 9:100570542-100570564 GGGTGCTAAGATAACTCAATGGG - Intronic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1059667189 9:116459130-116459152 GGGTGCCAAGAAAATACAGTGGG + Intronic
1059795468 9:117691056-117691078 GGGTGCCAATATCATTCAGTAGG + Intergenic
1059947484 9:119426027-119426049 AGGTGCCAGGACAATTCAGTAGG - Intergenic
1060020065 9:120121929-120121951 GGATGCCAAGACCATTCAGTGGG - Intergenic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1061220785 9:129250094-129250116 GGGTGCCAAGACCATTCAATGGG + Intergenic
1061668940 9:132177564-132177586 GGTTGCCAAGAACATTTAGTGGG - Intronic
1062140346 9:134953759-134953781 GGGTGCCAAGACCATTCAATAGG - Intergenic
1062307487 9:135917363-135917385 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1062335605 9:136064931-136064953 GGGTGCCAAGACCATTCAATGGG + Intronic
1203744251 Un_GL000218v1:32180-32202 GAGTGCCAAGATTATTCAGTGGG + Intergenic
1203565858 Un_KI270744v1:87334-87356 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1203602237 Un_KI270748v1:23893-23915 GGGAGCCAACATTATTCAGTGGG - Intergenic
1187119422 X:16389582-16389604 GTGTGCCAAGACAATTAAATGGG + Intergenic
1187129247 X:16485716-16485738 GGGTGCCAAGACAAATCAATGGG + Intergenic
1187228813 X:17401114-17401136 GGGTGCCAAGACAATTCAATGGG + Intronic
1187362176 X:18638914-18638936 GGGTGCCAAGATCATTCAATGGG + Intronic
1187777526 X:22779010-22779032 GGGTACCAAGAAAATTCAGTGGG - Intergenic
1187908451 X:24088710-24088732 AGATGCCAAGATAATCCAGTGGG - Intergenic
1187910587 X:24107600-24107622 GGGTGCCAAGACAATTCCATGGG - Intergenic
1188495277 X:30776724-30776746 GGTTGTCAAGATAATTCAATGGG - Intergenic
1188766010 X:34091735-34091757 GGATGCCAAGATGATTCAGTCGG + Intergenic
1189404443 X:40707219-40707241 GGGTGACAAGACAATTAAACAGG + Intronic
1189862264 X:45285634-45285656 GGGTGCCAAGACAATTCAATTGG - Intergenic
1190159890 X:48024116-48024138 GGGTGCCAAGATCATTTAATGGG - Intronic
1190428856 X:50358760-50358782 GGGTATCAAAATAATTATGTGGG - Intergenic
1190459539 X:50658593-50658615 GGCTGCCAAGCTAATGAATTTGG - Intronic
1190538290 X:51450668-51450690 AGGGGCCAAGATAATTTTGTGGG - Intergenic
1190583291 X:51909741-51909763 GGGTGCCAAGATTACTCAATGGG - Intergenic
1190631422 X:52390698-52390720 GGGTGCCAAGATAATTCAGTGGG + Intergenic
1190635491 X:52428882-52428904 AGGTGCCAAGATAATTTAGTGGG - Intergenic
1190639468 X:52468868-52468890 AGGTCCCAAGATAATTTAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190835783 X:54099732-54099754 GGGTGCCAAGATAATTCAATGGG - Intronic
1190860068 X:54336362-54336384 GGTTGCCAAGAAAATTCAGTGGG + Intronic
1190934796 X:54988713-54988735 GGGTGCCAAGACAATTAAGTAGG + Intronic
1190994283 X:55590897-55590919 GAGTGTCAAGATCATTAAGTGGG + Intergenic
1191637754 X:63395910-63395932 GGATGCCAAGATTATTCAATTGG - Intergenic
1191653820 X:63574487-63574509 GGATGCCAAGACAATTTAATGGG + Intergenic
1192002298 X:67166115-67166137 GGGTGCTAAGACAATTCAATGGG + Intergenic
1192090789 X:68153294-68153316 TGGTGTCAAAATATTTAAGTTGG - Intronic
1192241547 X:69333812-69333834 GAGTGTCAAGACAATTCAGTGGG - Intergenic
1192413487 X:70955801-70955823 GGGTGCCAAGACAATGCAATAGG + Intergenic
1192571486 X:72209830-72209852 GGGCGCCAAAATAATTCACTGGG + Intronic
1192622370 X:72691173-72691195 AGGTGCCAAGATAATTCAATGGG - Intronic
1193875041 X:86852058-86852080 GGGTGCCAAAATCATTCAGTGGG - Intergenic
1193903162 X:87208798-87208820 GAGTTCCAAGATCATTCAGTAGG + Intergenic
1194350018 X:92815350-92815372 GGATGCCAAGATCATTCAATAGG + Intergenic
1194375722 X:93131310-93131332 GGGTGCCAAGACAATTAAATGGG - Intergenic
1195056811 X:101154022-101154044 GGGTGCCAAGACATTTTAATGGG - Intronic
1195745133 X:108109741-108109763 GGGTGCCAAGACCATTCAATGGG - Intronic
1195765945 X:108297264-108297286 GGTTGTTAAGATAATTAAATAGG - Intronic
1196003394 X:110810046-110810068 GGGTTTCAAGATAATTGAGGTGG - Intergenic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196281359 X:113826866-113826888 AGGTGCCAAGAAAATTCAATGGG + Intergenic
1196801767 X:119550438-119550460 GGGTGCCAAGACCATTAAGGGGG + Intronic
1197038877 X:121910237-121910259 GGGTTCCAAGTTAATTCAATGGG - Intergenic
1197403634 X:126025068-126025090 GAGTGCTAAGACAATTCAGTGGG - Intergenic
1197659922 X:129159308-129159330 GGATGCCAAGAGAATTTAATAGG - Intergenic
1198170463 X:134100298-134100320 GGTTGCTAAGATAAGAAAGTAGG + Intergenic
1198195912 X:134361770-134361792 GGGTGCCAAGACAATTCAGCAGG + Intergenic
1198297256 X:135299880-135299902 GGGTGCCAAAACAATTTAATAGG - Intronic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1198881035 X:141281379-141281401 AGGTACCAAGGTAATTAAATGGG - Intergenic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1201157576 Y:11147161-11147183 GGGTGCCAAGATTATTCAGTGGG + Intergenic