ID: 992995106

View in Genome Browser
Species Human (GRCh38)
Location 5:82324721-82324743
Sequence CCTCACCCGCCCCCAAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992995106_992995113 16 Left 992995106 5:82324721-82324743 CCCCTTCTTGGGGGCGGGTGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
Right 992995113 5:82324760-82324782 TCCTCAGAGGAGACACCAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 224
992995106_992995110 3 Left 992995106 5:82324721-82324743 CCCCTTCTTGGGGGCGGGTGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
Right 992995110 5:82324747-82324769 AGCCACTTGCTCTTCCTCAGAGG 0: 1
1: 1
2: 1
3: 32
4: 377
992995106_992995112 15 Left 992995106 5:82324721-82324743 CCCCTTCTTGGGGGCGGGTGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
Right 992995112 5:82324759-82324781 TTCCTCAGAGGAGACACCAAAGG 0: 1
1: 0
2: 3
3: 52
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992995106 Original CRISPR CCTCACCCGCCCCCAAGAAG GGG (reversed) Intronic
904567126 1:31434711-31434733 CCACACCGGCCCCCATGCAGTGG - Intergenic
904830100 1:33300789-33300811 CCTCCCCCGCCCCCCAGACTTGG + Intergenic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905108467 1:35577624-35577646 CCTCAGCCCCACCCCAGAAGCGG + Intronic
905662844 1:39740638-39740660 CCTCACCCACCCCCATTATGGGG - Intronic
905900115 1:41575804-41575826 CTTCACACTCCCCCATGAAGAGG + Intronic
909806061 1:79875466-79875488 CCTCATACACCCCCAGGAAGGGG + Intergenic
912506660 1:110161397-110161419 CCTGAAGAGCCCCCAAGAAGAGG - Intronic
920031431 1:203039560-203039582 CCCCACCCACCTCCAAGAATAGG - Intronic
920264136 1:204709253-204709275 CCTCACCCTCCCCCAACATCTGG - Intergenic
923355713 1:233153243-233153265 CCTCAGTCGCCCCTGAGAAGAGG - Intronic
923975305 1:239255890-239255912 CCACACCTCCCCCCAAGCAGAGG + Intergenic
1063131498 10:3181844-3181866 CCTCACTGTTCCCCAAGAAGGGG - Intergenic
1064033921 10:11900398-11900420 CTTCACCCACCCACAAGAGGTGG + Intergenic
1065320596 10:24505555-24505577 CCTCAGCCACCCACAAGGAGGGG - Intronic
1067465163 10:46492167-46492189 CCCCACCCTACCCAAAGAAGAGG + Intergenic
1067622024 10:47892434-47892456 CCCCACCCTACCCAAAGAAGAGG - Intergenic
1068555001 10:58448641-58448663 CCACACCTCCCCGCAAGAAGAGG + Intergenic
1069636718 10:69929601-69929623 CCCCACCTGACCCAAAGAAGGGG + Intronic
1069874112 10:71551318-71551340 CCTGACCTTCCCCCAGGAAGTGG - Intronic
1070647616 10:78212571-78212593 CCTGCCCCGCCCCCCAGCAGTGG + Intergenic
1071498078 10:86182268-86182290 TCTCTCCCGGCCCCAAGCAGGGG + Intronic
1071963042 10:90824780-90824802 CCTCCCCCTTCCACAAGAAGAGG - Intronic
1073212852 10:101818648-101818670 CATTACCCGCCCCGAAGGAGGGG + Intergenic
1075022283 10:118960652-118960674 CCACACCCAGCCCCATGAAGAGG - Intergenic
1075527234 10:123197162-123197184 CCTCAGCGTCCACCAAGAAGAGG - Intergenic
1076391725 10:130108320-130108342 CCTTACCCTCCCCCAAGACCTGG + Intergenic
1077447090 11:2600832-2600854 CATCAGACTCCCCCAAGAAGTGG - Intronic
1077858750 11:6156748-6156770 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1078179891 11:9003137-9003159 CCAGCCCCGCCCCCAAGGAGTGG - Intronic
1079762386 11:24345546-24345568 CCTCCCTTGCACCCAAGAAGAGG + Intergenic
1082147093 11:48683568-48683590 CCTCACCCTGCCCCGAGAGGTGG - Intergenic
1083643378 11:64157887-64157909 GCTCACCGGCCCGCAAGAACAGG + Intronic
1084430037 11:69105912-69105934 CCTCACCCCACCCCAAGCACAGG - Intergenic
1084724426 11:70931636-70931658 CCTCACCCGCCCCTCTGAAAGGG + Intronic
1084772408 11:71352288-71352310 CCTCACCCGCTCTCTAGATGAGG + Intergenic
1089554983 11:119311274-119311296 CCTCACCCAGCTCCAGGAAGAGG + Exonic
1089603271 11:119627680-119627702 CCTCTCCCTCGCCAAAGAAGGGG - Intronic
1092162634 12:6324316-6324338 CCTTGCCCGACCCCAGGAAGAGG - Intronic
1099478629 12:83140094-83140116 CCACACCTGCCCCCAAGCAGAGG - Intergenic
1104764103 12:131315361-131315383 CCTCTCCCTCCCCCGAGCAGTGG - Intergenic
1107339196 13:39387946-39387968 ACTCACCGGCCCCCAGGAAAGGG - Intronic
1107508985 13:41062052-41062074 CCTCCCCCGCCCACTGGAAGCGG + Intronic
1107655831 13:42591395-42591417 CCTCACCCTCCCCAGAGGAGAGG - Intronic
1108574161 13:51777208-51777230 CCGCACCCGCCCCCCACAAGAGG + Intronic
1110152883 13:72276217-72276239 CCTTACCAACCCCCAAGCAGGGG + Intergenic
1113291893 13:108916282-108916304 CCTCACCCGCAGCTAAGCAGAGG + Intronic
1114551271 14:23534129-23534151 GCTCACCCACCTCCAAGGAGGGG - Exonic
1115948525 14:38693827-38693849 CCTCACCCATCCCCCAGCAGTGG + Intergenic
1116351847 14:43872471-43872493 CCTCCTCCACCCCCAAGCAGTGG - Intergenic
1116964263 14:50998227-50998249 CCTCCCTCGCCCCTCAGAAGGGG - Intronic
1118749377 14:68795314-68795336 CCCCACCCCCCCCAAAAAAGAGG + Intronic
1120521356 14:85531059-85531081 CCCCACCCGCCCCCACCAACTGG - Intronic
1122270671 14:100567417-100567439 CCACCCCCGCCCCCCAGAGGCGG + Intronic
1122500050 14:102191407-102191429 CATCCCCCGCCCCCCAGAAGAGG + Intronic
1125013352 15:34905087-34905109 CCCCACCCCCCCCAAAAAAGAGG - Intronic
1127290959 15:57570639-57570661 ACTCACTCACCCCCAAGAAAGGG - Intergenic
1128161827 15:65427927-65427949 CCTCAGCAGCCCCCAAGCAGTGG + Intergenic
1128519238 15:68364670-68364692 CCTCTCCTGACCCCAAGCAGTGG + Intronic
1128850461 15:70949961-70949983 CCTCACCCTCCCCCATCAAGTGG + Intronic
1131789586 15:95949430-95949452 CCCCACCCCCCCCCAAAAAATGG - Intergenic
1132373552 15:101313662-101313684 CCTCACCCACTCCCAGGAGGTGG + Intronic
1132642603 16:984644-984666 CCCCACCCGCCCCACAGAAGGGG + Intronic
1132680251 16:1137577-1137599 CCCCACCCCACCCCCAGAAGCGG + Intergenic
1134165654 16:11927415-11927437 CATCACCCGAGCCCAAGAGGCGG - Exonic
1134257869 16:12626498-12626520 CCCCACCCCCCCCCAAAAAGGGG + Intergenic
1134803040 16:17103229-17103251 CCTCCCCTGCCCCCAAGACTGGG - Exonic
1135310629 16:21402383-21402405 CATCACCCGAACCCAAGAGGCGG - Exonic
1135310649 16:21402470-21402492 CATCACCCGAACCCAAGAGGCGG - Exonic
1135363577 16:21834817-21834839 CATCACCCGAACCCAAGAGGCGG - Exonic
1135363597 16:21834904-21834926 CATCACCCGAACCCAAGAGGCGG - Exonic
1135448195 16:22536177-22536199 CATCACCCGAACCCAAGAGGCGG + Exonic
1135448215 16:22536264-22536286 CATCACCCGAACCCAAGAGGCGG + Exonic
1136307354 16:29381458-29381480 CATCACCCGAACCCAAGAGGCGG - Exonic
1136307374 16:29381545-29381567 CATCACCCGAACCCAAGAGGCGG - Exonic
1136320899 16:29483788-29483810 CATCACCCGAACCCAAGAGGCGG - Intronic
1136320919 16:29483875-29483897 CATCACCCGAACCCAAGAGGCGG - Intronic
1136435452 16:30223041-30223063 CATCACCCGAACCCAAGAGGCGG - Exonic
1136435472 16:30223128-30223150 CATCACCCGAACCCAAGAGGCGG - Exonic
1136500927 16:30669387-30669409 CCTCACCCGCCTCATAGAAGCGG - Exonic
1136590692 16:31216145-31216167 CTTGACCCGCCTCCTAGAAGGGG + Exonic
1137734381 16:50713093-50713115 CCTTGCCTGCCCCCAAGATGTGG - Intronic
1139543528 16:67636783-67636805 CCCCACCACCCGCCAAGAAGCGG + Exonic
1140384183 16:74519713-74519735 CCCCACCCACTCCCCAGAAGCGG + Intronic
1141868813 16:86770209-86770231 TCTCAACCACCCCCAAGATGTGG - Intergenic
1142391426 16:89803414-89803436 GCTCACCCGCCCCTCTGAAGTGG - Intronic
1144250257 17:13409206-13409228 CCTCACCCATCCCCACTAAGAGG + Intergenic
1146272575 17:31493978-31494000 CCTCAGCCACCCCAAAGCAGGGG - Intronic
1148743089 17:49903827-49903849 CCTCCCCCGCCACCTATAAGGGG + Intergenic
1148760097 17:49995121-49995143 CCTCCCCCTCCCCCCAGACGCGG - Exonic
1148908555 17:50927292-50927314 CCGCACCCAGCCCCAAGATGTGG + Intergenic
1149332769 17:55603894-55603916 TCTCATCCTCCTCCAAGAAGTGG + Intergenic
1149333037 17:55606215-55606237 TCTCATCCTCCTCCAAGAAGTGG + Intergenic
1151288497 17:73131342-73131364 CCTCCCCCGACCCCAAGAACTGG + Intergenic
1151621778 17:75250071-75250093 GCTCACCCGCCCACAGGAACGGG + Intronic
1151746546 17:76014658-76014680 CCTGACCTGCCCCCAGGAGGAGG - Intronic
1151954642 17:77374195-77374217 CCTCATCCGCCTCCCAGAATCGG + Intronic
1152182036 17:78828513-78828535 CCTGACCTGCCCCCACTAAGAGG + Intronic
1152635202 17:81428063-81428085 CCTCCCCTGCACCCAGGAAGAGG - Intronic
1152795381 17:82303844-82303866 CCTCCCCTGCCCCACAGAAGTGG - Intergenic
1153424142 18:4944559-4944581 CCTCACAGGCCCCCAGGAAAGGG + Intergenic
1154253628 18:12765139-12765161 CTGCACCCGCTTCCAAGAAGGGG + Intergenic
1154270131 18:12911688-12911710 CCTCAGACGCCCTCCAGAAGAGG - Intronic
1155972104 18:32092453-32092475 CCTCACCCCGCCCCAGGACGCGG - Intronic
1156683528 18:39618431-39618453 CCACACCTCCCCCCAAGCAGAGG - Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160974683 19:1787020-1787042 CCTCTCCCCGCCCCAAGGAGCGG + Intronic
1161197497 19:2995053-2995075 CCTTCCCCCCCCCCAACAAGGGG + Exonic
1161667390 19:5585609-5585631 CCACACCCACCTCCAGGAAGGGG + Intergenic
1161873340 19:6887629-6887651 CCTCACACTCACCCCAGAAGAGG - Exonic
1162301552 19:9847819-9847841 CCTCACCCACACCCAAGAAGAGG - Intronic
1162752133 19:12835317-12835339 CCTAACCCACCCCCGAGAGGCGG - Exonic
1166379664 19:42349389-42349411 CCCCACCCCCTCCTAAGAAGAGG - Intronic
1166481744 19:43179906-43179928 CCTCACCTGCCCTCTACAAGGGG - Intronic
1166796450 19:45428963-45428985 ACTCACCCGGCCCCAAGCGGAGG + Intronic
1166896401 19:46024682-46024704 CCTCACCCCGACCCCAGAAGTGG + Intergenic
1167169407 19:47821343-47821365 CCACCTCCGCCCCCAAAAAGAGG + Intronic
925172649 2:1759696-1759718 CCACACCCCCCCACAAGCAGAGG + Intergenic
926787787 2:16535724-16535746 CCACACCCAGCCCCAAGAACCGG - Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927240298 2:20915075-20915097 CCTCACCCACCCACAAGGAGAGG - Intergenic
927493986 2:23540183-23540205 CCTGCCCAGCCCCCCAGAAGTGG + Intronic
931021963 2:58056086-58056108 CCTCCCCCACCCCCTAAAAGAGG + Intronic
935059117 2:99592930-99592952 CCTCCCCCCCCCCCAAAAAAAGG + Intronic
935321370 2:101892568-101892590 ACTCCCCCACCCCCAAGAAAAGG - Intronic
937045558 2:118849459-118849481 CCTCGCCTGCTCCCAAGATGCGG - Intergenic
937346655 2:121130282-121130304 CCCCAACCTCCCCCAACAAGTGG - Intergenic
939580695 2:143942199-143942221 CCTCTCCCAACCCCAAGGAGAGG - Exonic
945907935 2:215615271-215615293 CCTCACCTCCCCACAAGCAGAGG + Intergenic
947793827 2:232882220-232882242 CCTCACTGGCCCCCAACAGGAGG - Exonic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1175522310 20:59609649-59609671 CCTCTCCCACGCCCAGGAAGGGG - Intronic
1175874604 20:62223451-62223473 CAACACCCAGCCCCAAGAAGGGG + Intergenic
1175907494 20:62388050-62388072 CCTCTTCCACCCTCAAGAAGCGG - Intronic
1176705584 21:10118381-10118403 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1177342099 21:19816541-19816563 CCTCTCCCCACCCCATGAAGAGG - Intergenic
1181039488 22:20185044-20185066 CCTCACCTGCCTCACAGAAGGGG - Intergenic
1181478084 22:23180798-23180820 CCTCACCTGCCACCAGGGAGTGG + Exonic
1181731656 22:24851403-24851425 CCTCTCCAGCCCCCAAGAGGTGG + Intronic
1182585028 22:31340032-31340054 TCTAACCAGCCCCCAAGAAGTGG + Intronic
1183049503 22:35249307-35249329 CCTCAGCCTCCCCCAAGTACTGG + Intergenic
1183050584 22:35257725-35257747 CCGCAGCCGCCCCCAGGAAGGGG + Intronic
1183152798 22:36051220-36051242 CCTCACCCTCCCCCAAATACTGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954764000 3:52897664-52897686 CCCCACCCGCCCCCGAGGGGCGG + Intergenic
955044290 3:55345157-55345179 CTTCCCCCGTCCCCAACAAGGGG - Intergenic
958936824 3:100264041-100264063 TCTCATCAGCCCCCCAGAAGAGG + Intronic
960529988 3:118753463-118753485 CCCCACCTGGCCCAAAGAAGGGG - Intergenic
960853453 3:122079270-122079292 CCTCACCCCCACCCAGGAAGAGG - Intronic
961088644 3:124091230-124091252 CCTCACCCTGCCCCAACAAGCGG - Intronic
961648974 3:128408099-128408121 TGACACCCGCCCTCAAGAAGCGG + Exonic
961826088 3:129599824-129599846 GCTCACCAGCCACCAGGAAGAGG + Intronic
963603296 3:147394971-147394993 CTTCTCCCGCCCCCAAAATGGGG + Intronic
966946094 3:184778064-184778086 CATCCCCTACCCCCAAGAAGAGG + Intergenic
967930710 3:194688165-194688187 CCTTGCCCGCCCCCAGGAAGGGG + Exonic
968077411 3:195824140-195824162 CCTCACCTGCCTCCATGAGGCGG + Intergenic
968583988 4:1407441-1407463 CTTAACCCGCCCCCAAAAGGGGG + Intergenic
968657959 4:1786766-1786788 CCTCTCCAGCCCTCAGGAAGTGG - Intergenic
970692037 4:18630956-18630978 CCACACCTGCCCGCAAGCAGAGG + Intergenic
971095784 4:23400203-23400225 CCTCCCCCGCCCTCCAGCAGTGG - Intergenic
972468914 4:39384940-39384962 CCTCCCCCACCCCCCAGCAGCGG - Intergenic
980739222 4:136928982-136929004 CCCCACCTCCCCCCAAGATGAGG - Intergenic
982281106 4:153684399-153684421 CCCGACCCGACCCCAGGAAGGGG - Intergenic
982721968 4:158868874-158868896 CCTCACTGGCCTCCAAGGAGGGG - Exonic
984180805 4:176480240-176480262 CCCCACCCACCCCCAGCAAGTGG - Intergenic
986745393 5:10739511-10739533 CCTCACCCAGGACCAAGAAGAGG + Intronic
989339525 5:40357735-40357757 CCTCACCATACCCCAAGAAGTGG + Intergenic
991708721 5:69385382-69385404 CCTCAGCCTCCCCCGAGTAGTGG + Intronic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
994028459 5:95113415-95113437 CCTCCCCCATCCCCAAGCAGTGG + Intronic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998146953 5:139734490-139734512 CCTCACCCTCACCCACGAAAAGG - Intergenic
999144322 5:149382315-149382337 CCTCACCCGACCCCTGGAATCGG - Intronic
999333625 5:150695981-150696003 CCCCTCCCGCCCCCCAGAAAGGG + Intronic
999723912 5:154419291-154419313 CCTCATCAGCCCCCGAGAGGAGG + Exonic
1001207966 5:169781779-169781801 CCTCTCCCGCCCCCACAGAGAGG + Intronic
1002070098 5:176674021-176674043 CCTCACCCACCCCCACCCAGTGG - Intergenic
1004053579 6:12112682-12112704 CCTCACCGCCCCCCTAGCAGTGG + Intronic
1005626404 6:27666463-27666485 CCTCAGCCCTCCCCAAGTAGCGG - Intergenic
1005935505 6:30517944-30517966 CCACACCTCCCCCCAAGCAGAGG - Intergenic
1005958829 6:30682607-30682629 CCCCACCCCCACCCAAGCAGCGG + Intronic
1006108276 6:31729469-31729491 CCTCACAAGCCCCCAAGCAGGGG - Exonic
1006847715 6:37074341-37074363 ACACACCTGCCTCCAAGAAGAGG - Intergenic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1007367777 6:41406909-41406931 CCTCGCCCGCCCCCAAGCCTAGG - Intergenic
1010787432 6:80020912-80020934 CCAAACCCATCCCCAAGAAGGGG + Intronic
1013745034 6:113335203-113335225 CCCCACCCCCCCCCAAAAAAAGG - Intergenic
1014798286 6:125749539-125749561 CCTCACCCGCCCCCGCGCACCGG - Intronic
1016880397 6:148905545-148905567 CCTCCCCAGCCCCCATTAAGGGG + Intronic
1018938067 6:168287016-168287038 CCTTACCCTCCCCCAAGACCTGG - Intergenic
1019735045 7:2646458-2646480 CCCCACCAGGCCCCAAGGAGAGG - Intronic
1021065801 7:16170956-16170978 CCACACCTCCCCACAAGAAGAGG + Intronic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1026273132 7:68853538-68853560 CCTCACCCACACACAAGAGGTGG + Intergenic
1026277146 7:68889926-68889948 CCTCACCCAGCCCCATGAGGTGG + Intergenic
1031869395 7:127075728-127075750 CCTCTCCCTCCCCCAATAATGGG - Intronic
1031899557 7:127393436-127393458 GCTCTCTCGCCCCCAAGAAGCGG - Intronic
1034502764 7:151461538-151461560 CGTTACCCTCCCCCAAGAAGGGG - Intergenic
1034575027 7:151989263-151989285 CCTCAGCCTCCCCCAAGAGCTGG + Intronic
1035341797 7:158166977-158166999 CACCAGCCGCCCCCCAGAAGTGG - Exonic
1036740299 8:11355145-11355167 ACTCACTCGCCCCCTGGAAGAGG - Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1040604692 8:48920260-48920282 ACTCACTCGCCCCAAAGATGAGG + Exonic
1041012491 8:53558645-53558667 ACACACCCGCCCCCAGGAAAGGG + Intergenic
1041251583 8:55939758-55939780 CGTCACCCTCCCCGAAAAAGCGG - Intronic
1041729369 8:61049253-61049275 CATGGCCCGCCCACAAGAAGAGG + Intergenic
1043481281 8:80655184-80655206 CCTCCCCCGCCCCCCACAACAGG - Intronic
1044821745 8:96159997-96160019 CCCCACCAGCCACCAACAAGCGG + Intronic
1044920927 8:97168555-97168577 CCTCACCCACCCTCTACAAGTGG + Intergenic
1044932488 8:97263129-97263151 CCTAGCCCGCAACCAAGAAGAGG + Intergenic
1045507063 8:102786215-102786237 CCTCACCCCCTCCTAACAAGGGG + Intergenic
1049342906 8:142123311-142123333 CCTCACCTTCCCCCAAGCTGGGG - Intergenic
1049358658 8:142201362-142201384 CCTCACCTGCCACCCAGAACCGG + Intergenic
1049599157 8:143499022-143499044 CGTGAGCCTCCCCCAAGAAGGGG + Intronic
1049700819 8:144011503-144011525 CCTCTCCCTGCCCCAAAAAGAGG + Intronic
1049758998 8:144323427-144323449 CCTCACAGGCCCCCATGAGGAGG + Intronic
1050878989 9:10675626-10675648 CCTCACATGCCCCCAGGAAAGGG - Intergenic
1051101720 9:13529845-13529867 CCTGACCCCACCCCAGGAAGTGG + Intergenic
1051942783 9:22529158-22529180 CCCCACCCACCCCCACAAAGTGG + Intergenic
1052476722 9:28970519-28970541 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1052974234 9:34400097-34400119 CCTCACCCCAGCCCAAGACGTGG - Exonic
1053642864 9:40105505-40105527 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1053763289 9:41359985-41360007 CTTCACCCAGCCCCAAGATGAGG - Intergenic
1054323722 9:63702756-63702778 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1054541898 9:66271152-66271174 CTTCACCCAGCCCCAAGATGAGG - Intergenic
1055373658 9:75625790-75625812 CCTCACACACCCCCAGGAAAGGG - Intergenic
1055502338 9:76913863-76913885 CCTCACCCCTTCCCAAAAAGTGG + Intergenic
1057293880 9:93824399-93824421 CCACACCCGGCCCCAGCAAGGGG + Intergenic
1057670647 9:97084637-97084659 GCTGACCCGCCCCCAAGTAAGGG - Intergenic
1058864587 9:109149866-109149888 CTACACCCTCCCCCATGAAGGGG - Intronic
1059422883 9:114203720-114203742 CCCCATCAGCCCCCAGGAAGTGG - Intronic
1059757150 9:117304276-117304298 CCTCACCCCACCACAAGATGGGG + Intronic
1060406575 9:123375890-123375912 CCCCACCCCGCCCCAGGAAGGGG - Intronic
1060479348 9:124008927-124008949 CCTCCCCCTCCCCCAGAAAGTGG - Intronic
1060934774 9:127508585-127508607 CCTCAGCGGCACCCAGGAAGGGG - Intronic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1061876406 9:133546325-133546347 ACCCACCCGGCCCCAGGAAGAGG + Intronic
1062105514 9:134752827-134752849 CCCCACCCCCCACCAACAAGGGG - Intronic
1062159414 9:135071581-135071603 CCTCAACAGCTCCCAAGAGGGGG + Intergenic
1062542211 9:137046453-137046475 CCTCACCCGCACCCGCGATGGGG + Intergenic
1202790617 9_KI270719v1_random:88490-88512 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1187850480 X:23586811-23586833 CCTTACCAGCCTCCAAGAAAAGG + Intergenic
1189138413 X:38574880-38574902 TCTCACCCACACCCAAGCAGAGG - Intronic
1193317257 X:80077856-80077878 CCTCACATGCCCCCAGGAAAGGG - Intergenic
1195564172 X:106323049-106323071 CCTCTCCTTCCCCCAAGTAGGGG - Intergenic
1196083137 X:111655010-111655032 CACCAGCCGCCCCCCAGAAGTGG - Intergenic
1196138238 X:112232865-112232887 CCTCAGCTCCCCTCAAGAAGTGG - Intergenic
1197075582 X:122349542-122349564 CCTCACCCACCCCCGAGCAGTGG + Intergenic
1197953020 X:131918341-131918363 CCTCCCCCACTCCCCAGAAGTGG + Intergenic
1198635036 X:138688251-138688273 CCTCGCCCGGCCCCAAAAATTGG + Intronic
1199139013 X:144288013-144288035 CCTCCCCCATCCCCCAGAAGAGG - Intergenic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic