ID: 992995538

View in Genome Browser
Species Human (GRCh38)
Location 5:82328986-82329008
Sequence TTCGTGGCTCTCAGCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 16, 1: 221, 2: 448, 3: 244, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992995538 Original CRISPR TTCGTGGCTCTCAGCTCTGA AGG Intronic