ID: 992997748

View in Genome Browser
Species Human (GRCh38)
Location 5:82349116-82349138
Sequence TGATGCAATGAGAGGATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992997744_992997748 10 Left 992997744 5:82349083-82349105 CCCCTTCATGGCATCTAAGGCTG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 992997748 5:82349116-82349138 TGATGCAATGAGAGGATTCTAGG 0: 1
1: 1
2: 2
3: 16
4: 213
992997746_992997748 8 Left 992997746 5:82349085-82349107 CCTTCATGGCATCTAAGGCTGAA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 992997748 5:82349116-82349138 TGATGCAATGAGAGGATTCTAGG 0: 1
1: 1
2: 2
3: 16
4: 213
992997745_992997748 9 Left 992997745 5:82349084-82349106 CCCTTCATGGCATCTAAGGCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 992997748 5:82349116-82349138 TGATGCAATGAGAGGATTCTAGG 0: 1
1: 1
2: 2
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992997748 Original CRISPR TGATGCAATGAGAGGATTCT AGG Intronic
900914074 1:5622076-5622098 CACAGCAATGAGAGGATTCTGGG - Intergenic
901321015 1:8339871-8339893 TGAAGCAATGAGGGGATTACAGG - Intronic
903239123 1:21970972-21970994 AGATGCCAAGAGAGGGTTCTTGG - Intergenic
903243033 1:21996648-21996670 AGATGCCAAGAGAGGGTTCTTGG - Intronic
903805001 1:25998998-25999020 GGATGGAAGGAGAGTATTCTCGG + Intergenic
907700418 1:56781327-56781349 TGAGGGAAAGAGAGGAATCTAGG - Intronic
908207544 1:61866707-61866729 AGATGCCAAGAGAGGGTTCTTGG + Intronic
910895182 1:92061724-92061746 TTATGAAATGAGAAAATTCTTGG + Intronic
910927112 1:92409019-92409041 TGATGGAATGAGAAGAGGCTGGG + Intergenic
912671297 1:111628878-111628900 TGACGAAATGATAGGAATCTTGG - Intronic
913117350 1:115709750-115709772 GGATGCAAGGATAAGATTCTTGG - Intronic
914169815 1:145213476-145213498 TAATTCAATGAGAGGAGACTTGG - Intergenic
914698965 1:150113211-150113233 TGTTTCAATGAGATGACTCTTGG - Intronic
917204207 1:172553077-172553099 TGTAGCAATGAGGGGATTCAAGG + Intronic
921267555 1:213435972-213435994 TAATGCCTTGAGAGGATTCCAGG - Intergenic
921385358 1:214563379-214563401 AGACGCAATCAGAGGAATCTAGG + Intergenic
921699838 1:218256118-218256140 TGAGGCATTGAGAGAAGTCTGGG + Intergenic
923049073 1:230377824-230377846 TGATGCAATGCTAGCATTTTGGG + Intronic
1063469928 10:6276067-6276089 TTAGGGAATGAGAGGATTTTTGG + Intergenic
1064491913 10:15867096-15867118 TGGTTCAATGAAAGGAATCTAGG + Intergenic
1065738691 10:28776937-28776959 GGATGCAAAGAGAGGGTTATAGG + Intergenic
1065915109 10:30348679-30348701 TGATGAATCAAGAGGATTCTTGG - Intronic
1067837229 10:49649084-49649106 GGATGCAGGGAGAAGATTCTAGG - Intronic
1068349127 10:55820653-55820675 TGTTACAAAGAAAGGATTCTGGG - Intergenic
1068959253 10:62850199-62850221 AGATGCAATGACAGATTTCTAGG + Intronic
1070342466 10:75510530-75510552 TGAGGGTATGAGAGGCTTCTTGG + Intronic
1072243259 10:93517617-93517639 TGAAGTAATGAGAGGAATCGAGG + Intronic
1073602808 10:104863453-104863475 TGAAGAAGTGAGAGGATGCTGGG - Intronic
1074048588 10:109861953-109861975 GGATTTAAGGAGAGGATTCTGGG + Intergenic
1074183904 10:111085165-111085187 TGATGCAATGTGCGCATTCTGGG + Intergenic
1076157725 10:128216314-128216336 TGGGGCAATTAGAGGTTTCTGGG + Intergenic
1078947116 11:16081504-16081526 TCATGTAATGAGAGTTTTCTAGG - Intronic
1081830477 11:46107598-46107620 AGATGCAAGGAGTGTATTCTAGG + Intronic
1082766456 11:57172077-57172099 TAATGGAAAGAGAGGCTTCTGGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1084295244 11:68209239-68209261 TGTTGAACTGAGTGGATTCTAGG - Intronic
1086110421 11:83193100-83193122 TGCTACAGTGAAAGGATTCTCGG + Intergenic
1086232493 11:84587348-84587370 TGATGGAATGAGAGCAGTCTTGG - Intronic
1086358505 11:86032082-86032104 TGTTGCAAAGACAGCATTCTAGG - Intronic
1086558307 11:88138177-88138199 TAAGGAAAGGAGAGGATTCTGGG + Intronic
1089241532 11:117085497-117085519 CGATGAAATGAAAGGATTCTGGG + Intronic
1091134191 11:133173604-133173626 TTTTGCAATGAGAGGCATCTGGG - Intronic
1092646259 12:10576476-10576498 TGATGCAAAGAGAAGAATATTGG - Intergenic
1093813380 12:23513666-23513688 TGCTTCAATCATAGGATTCTTGG - Intergenic
1095806629 12:46326955-46326977 TGATTCACTGAGAAGATTTTGGG + Intergenic
1095904655 12:47365640-47365662 GGATTCAATGAGAAGATTCCTGG - Intergenic
1097704459 12:62853118-62853140 TGAATCAATGAGAAGTTTCTCGG + Intronic
1097724217 12:63056034-63056056 TATTGCAGTGAGAGCATTCTGGG + Intergenic
1098061552 12:66568698-66568720 TGCTGGAATAAGAGAATTCTGGG + Intronic
1103445463 12:120992136-120992158 TGAAGCAATGTGAGGAGTCCAGG + Intronic
1104161908 12:126189472-126189494 AGATGCCAAGAGAGGATTCTTGG - Intergenic
1105315808 13:19261539-19261561 GGATGCAATGAGAAGATCCCAGG + Intergenic
1108745104 13:53385510-53385532 TCAAGCAATGAGAAGTTTCTTGG + Intergenic
1109652694 13:65351333-65351355 AGACCCTATGAGAGGATTCTTGG + Intergenic
1111069345 13:83143410-83143432 TGTTATAATGAGAGGATTTTTGG - Intergenic
1111505361 13:89182986-89183008 TCATGACATGAGAGGATTATGGG + Intergenic
1111549328 13:89785685-89785707 TGATACAATTAAAGCATTCTAGG - Intergenic
1111828127 13:93294794-93294816 TGAAGCATTGAGAAGAGTCTGGG - Intronic
1112116848 13:96365295-96365317 TGAGGCATTGTGGGGATTCTGGG + Intronic
1113017986 13:105850127-105850149 TTGTGCAATGATAGGATTCACGG - Intergenic
1113296643 13:108965946-108965968 TGATGCCTTTAGAGGTTTCTTGG + Intronic
1119101490 14:71884092-71884114 AGATGCTAAGAGAGGGTTCTCGG - Intergenic
1119544409 14:75461229-75461251 GGATGCTCTGAGAGGATCCTTGG + Intronic
1120244407 14:81989765-81989787 TGATCCAATGAGCTCATTCTGGG + Intergenic
1126192664 15:45894985-45895007 TTTTGGAATGAGAGGATTCTAGG + Intergenic
1126701303 15:51370272-51370294 TGATCCCATCAGAGGATGCTGGG - Intronic
1127482073 15:59386891-59386913 AGATGCCAAGAGAGGGTTCTTGG + Intronic
1127576586 15:60297758-60297780 GGCTGCAATGGGAGGATTCCTGG - Intergenic
1128944857 15:71813255-71813277 TGATGTCAGGAGAGCATTCTCGG + Intronic
1129247315 15:74287377-74287399 TGAGGCAATGAGAGGATAGGAGG - Intronic
1130046053 15:80445718-80445740 TGATGCAGAGACAGGACTCTGGG + Intronic
1130957908 15:88639935-88639957 TGGGGAAATGAGAGGATTCTTGG + Intronic
1132114992 15:99129536-99129558 TGATGCCAGAAGAGGCTTCTTGG + Exonic
1133398958 16:5470768-5470790 AGATGCAATGGGAGGGTTCCAGG - Intergenic
1133652207 16:7823008-7823030 AGATGCCAAGTGAGGATTCTTGG - Intergenic
1133674386 16:8056797-8056819 TTCTATAATGAGAGGATTCTAGG + Intergenic
1133846736 16:9461349-9461371 TGATGCAATGAGAAGGTTCTGGG - Intergenic
1136900887 16:34036468-34036490 GGCTGAAATGAGAGGATTCTTGG - Intergenic
1140994629 16:80245766-80245788 GGCTGAAATGAGAGGATTCAAGG + Intergenic
1143120737 17:4605011-4605033 TGAAGCAATGGGAGGAGTCGGGG + Intronic
1144010080 17:11139373-11139395 TGAGATAAAGAGAGGATTCTGGG + Intergenic
1147872084 17:43594544-43594566 AGATCCCAAGAGAGGATTCTTGG + Intergenic
1149250370 17:54761292-54761314 TGTTTTAATGAGAGGATTCAGGG - Intergenic
1149346384 17:55740597-55740619 TGATGTCATGGGAGGATTTTAGG + Intergenic
1150133597 17:62682137-62682159 TCATGCCCTGAGAGGAGTCTGGG - Intronic
1155630858 18:27890695-27890717 TGTTGCTATGAGATGATTCCAGG + Intergenic
1155682390 18:28504517-28504539 TGATGCCTTGAGAACATTCTAGG + Intergenic
1158667622 18:59447074-59447096 TGATGAAATGATAGGATGTTCGG + Intronic
1158879330 18:61761581-61761603 AGATGGAAGAAGAGGATTCTGGG + Intergenic
1159863197 18:73673491-73673513 TGATGCAATGAGTAGAGTCCAGG - Intergenic
1160380812 18:78453950-78453972 TGATTCAATGAGATGAATCCAGG + Intergenic
1161202761 19:3025089-3025111 GGAAGCAATGAGAGGAAGCTTGG + Intronic
1161867382 19:6843188-6843210 TGTTTCAATGAGAGGTTTCTGGG + Intronic
1166476627 19:43131424-43131446 GAATGCAATGAGAGGTTTCCAGG - Intronic
1168700968 19:58439462-58439484 TGATGAAATGGAAGCATTCTGGG - Intronic
925208603 2:2027479-2027501 TGATGTACTGACCGGATTCTGGG + Intronic
926497686 2:13611949-13611971 TGATGCAATGAAAGAGTTTTTGG + Intergenic
928218496 2:29382522-29382544 TGATCAAATGAGAACATTCTGGG + Intronic
929195832 2:39183373-39183395 TGATGCACTGAGAGGATTCTTGG + Intronic
929965900 2:46536510-46536532 GGCTGCAGTGTGAGGATTCTGGG + Intronic
930393617 2:50791842-50791864 TAATTCAAAGAGAAGATTCTGGG + Intronic
931571550 2:63674001-63674023 AGAAGCAATGACAGTATTCTGGG - Intronic
931647733 2:64440425-64440447 TGGTGGAGTGAGAGGAGTCTTGG - Intergenic
932068296 2:68589928-68589950 TGAACAAATGAGAGGATGCTAGG - Intronic
933553510 2:83804769-83804791 TGAGGCAAGTAGAGGATTATGGG - Intergenic
935095514 2:99940806-99940828 AGATGCCAGGAGAGGGTTCTCGG - Intronic
935701627 2:105817292-105817314 TGATGCAACATGTGGATTCTGGG + Intronic
937588966 2:123591161-123591183 TGATGCAAGAAGTGGGTTCTTGG + Intergenic
937712512 2:124994550-124994572 AGATTCAAAGAGAGGGTTCTTGG - Intergenic
937851095 2:126637153-126637175 AGATGGCATGAGAGGCTTCTGGG + Intergenic
939560920 2:143730642-143730664 TCATGCAATGAGAAAATTTTAGG - Intronic
941350984 2:164435926-164435948 TGAAGCACTGAGAAGAATCTAGG - Intergenic
941501792 2:166288226-166288248 TCATGCAGTGAGATGATTATGGG + Intronic
941968293 2:171322370-171322392 AGACGCCAAGAGAGGATTCTTGG + Exonic
943320897 2:186440893-186440915 TGATAAAATGAGAGGAGTCCAGG - Intergenic
944532412 2:200680475-200680497 TGATGTAGTGAGAGGATTCCTGG - Intergenic
946079398 2:217104514-217104536 TGAAGCAAGGAGAAGATACTGGG + Intergenic
946829427 2:223712695-223712717 TGGTGCAAAGAGAGGTTCCTGGG - Intergenic
947184637 2:227444323-227444345 TAATGCAAGGAGAGGTTTCCTGG - Intergenic
948278083 2:236725371-236725393 TGATGAAATCAGATGAATCTTGG - Intergenic
1169657189 20:7938242-7938264 TGATGCAGTGTGAGGAATCAAGG + Intronic
1172627279 20:36354593-36354615 AGATGCAGTGAGGGGATCCTGGG - Intronic
1172841996 20:37907603-37907625 TGCTGCAGTGTGAGGCTTCTTGG - Intronic
1175302750 20:57954391-57954413 AGATGCAGTGGGAGGCTTCTTGG + Intergenic
1177228803 21:18292388-18292410 AGGTGCCAAGAGAGGATTCTTGG - Intronic
1177302662 21:19270402-19270424 TGATGCAATGAGATTTTGCTGGG + Intergenic
1177692585 21:24530947-24530969 TGAGACAATGAGAGTAATCTGGG - Intergenic
1179301601 21:40116497-40116519 TGATTCCATGACAGGATGCTGGG + Intronic
1180253823 21:46608079-46608101 AGATGTAAAGAGGGGATTCTTGG + Intergenic
1181638909 22:24186824-24186846 TGAGTCAATGAAAGGATTCCTGG + Intronic
1182456978 22:30458087-30458109 TGGTGCCATGAGAGGCTCCTTGG - Intronic
1182806350 22:33073911-33073933 TGCTGCCATGGGAGGATTATAGG - Intergenic
949725016 3:7034156-7034178 TGATGGAATGAGATCATTCAAGG - Intronic
949755704 3:7408510-7408532 TGATCTAATGAGAGGAGTCTAGG - Intronic
951589218 3:24245084-24245106 TGATGATATGAGAAGACTCTTGG + Intronic
952737540 3:36705356-36705378 TCCTGGAATCAGAGGATTCTGGG - Intergenic
955739847 3:62078819-62078841 GGATGCAATGCTGGGATTCTAGG - Intronic
956082813 3:65577788-65577810 TGATGCCATGGGAGGCTTCTGGG + Intronic
960701144 3:120440523-120440545 TGATGCAATGTGAGAAGTATTGG - Intronic
961407708 3:126693597-126693619 AGATCCCAAGAGAGGATTCTTGG - Intergenic
961595509 3:128012898-128012920 AGATGCCAAGTGAGGATTCTTGG - Intergenic
961624453 3:128251913-128251935 TGATGCATTGAGAAGATTGTGGG - Intronic
961928864 3:130512344-130512366 TGAATGAATGAGAGGAGTCTAGG - Intergenic
965211774 3:165799412-165799434 ATATGCAATGAGGGGATTTTAGG + Intronic
965637207 3:170794731-170794753 TGATGCAATGAGAGGTTAAAAGG - Intronic
967478887 3:189952040-189952062 TGATGCAATGAGAGGTTAAGTGG + Intergenic
969649180 4:8453602-8453624 TGATGCAGTGAAAGCACTCTTGG + Intronic
969974131 4:11080730-11080752 TTATTCAATGTGAGGATGCTGGG + Intergenic
972875486 4:43353488-43353510 TGTTGCACTAAGAGGATTTTTGG + Intergenic
974185931 4:58446239-58446261 AGACTCAAGGAGAGGATTCTGGG + Intergenic
978248411 4:106603367-106603389 TGATGCTGTCACAGGATTCTTGG + Intergenic
978459596 4:108936646-108936668 TGGTGAAATGAAAGCATTCTGGG - Intronic
978957562 4:114633402-114633424 TGATGGAAGGAGAGTATTCCAGG + Intronic
979864964 4:125742786-125742808 TGGTGCAATGAAAGGCTTCTAGG + Intergenic
981483785 4:145263706-145263728 AGATCCAAAGAGAGGATTGTGGG - Intergenic
981812709 4:148793862-148793884 TGATGAATTGAGATAATTCTGGG + Intergenic
982395043 4:154907275-154907297 TAATGCAGAGAGAGGATTGTAGG + Intergenic
983037737 4:162888158-162888180 TGATGCATAGATAGGATTCAAGG + Intergenic
984574943 4:181437285-181437307 TGAAGCAATTAGAGATTTCTGGG + Intergenic
985699489 5:1361944-1361966 TTATGCTATGAGGGGACTCTTGG + Intergenic
986497307 5:8357116-8357138 TAATGAAATGACGGGATTCTGGG - Intergenic
987133781 5:14882550-14882572 TGAGGCAATCAGATGATTCAGGG + Intergenic
987223493 5:15815253-15815275 GGATCCAATGAGATGCTTCTTGG + Intronic
989983545 5:50669296-50669318 TAATTCAATGAGAGGAGACTTGG + Intronic
990083495 5:51945503-51945525 TGCTGCAATGAGTTGACTCTGGG + Intergenic
991222075 5:64228064-64228086 TGAGCCAAGGAGAGGATTCCAGG - Intronic
992997748 5:82349116-82349138 TGATGCAATGAGAGGATTCTAGG + Intronic
995288827 5:110425631-110425653 TGATGAAATGAGGGGACTGTCGG - Intronic
995331827 5:110955276-110955298 TGATGTTATCTGAGGATTCTTGG - Intergenic
995801978 5:116006980-116007002 TGAAGCAAAGAGAGGAATCAAGG - Intronic
998685698 5:144522040-144522062 TTATGAAGTGATAGGATTCTGGG + Intergenic
999490686 5:152047500-152047522 TGATACAATGAATGGATTTTGGG - Intergenic
1001377588 5:171277270-171277292 TGATGCAGGGAGACGATCCTAGG - Intronic
1002641708 5:180633544-180633566 GGCTGCCATGAGAGGAGTCTGGG + Intronic
1004206725 6:13598373-13598395 TGATGAAATTAGGGGATGCTTGG + Intronic
1007486389 6:42183805-42183827 GGATGGAAAGAGAGGATTGTTGG + Intergenic
1008266178 6:49429254-49429276 TGATTCAATGACTGGAGTCTGGG - Intergenic
1008802702 6:55389406-55389428 TGGAGCAATGAGAGATTTCTGGG - Intronic
1014515273 6:122369971-122369993 TCATGCAATGAAAAGATTCATGG - Intergenic
1015717067 6:136203903-136203925 TGAGGCAAGGGGAGGAATCTGGG + Intergenic
1017883171 6:158576022-158576044 TGAAGCTTGGAGAGGATTCTGGG + Intronic
1017988114 6:159462541-159462563 GGCTCCAATGGGAGGATTCTTGG - Intergenic
1018363835 6:163098626-163098648 AGATCCAAAGAGAGCATTCTTGG + Intronic
1018499874 6:164395986-164396008 TTACTCAATGAGAGGCTTCTGGG + Intergenic
1018835551 6:167480813-167480835 ACATGCCAAGAGAGGATTCTTGG + Intergenic
1020349993 7:7209046-7209068 TGATTAAGTTAGAGGATTCTTGG - Intronic
1021111972 7:16705961-16705983 TGGTGCAATGGCAGGGTTCTGGG + Intronic
1021300804 7:18970861-18970883 TGATGGAATGAGGGATTTCTGGG + Intronic
1021803122 7:24327996-24328018 TTCTGTAATCAGAGGATTCTGGG + Intergenic
1021907859 7:25353396-25353418 TGAGGCAATGACATGATTCCAGG - Intergenic
1023805603 7:43870645-43870667 TCATGTAATCAGAGGAATCTTGG - Intronic
1024529465 7:50379348-50379370 GGATACACTGAGAGGATTCAGGG + Intronic
1028149716 7:87357544-87357566 AGATGCTAAGAGAGGGTTCTTGG + Exonic
1029588270 7:101489454-101489476 AGACGCCAAGAGAGGATTCTTGG + Intronic
1030601291 7:111596187-111596209 AGATGCCAAGAGAGGGTTCTTGG + Intergenic
1030620398 7:111783600-111783622 TGGTGAATTGAGAGGATTCTCGG - Intronic
1030795984 7:113788697-113788719 TGATGCCATGACAGGAGACTAGG + Intergenic
1031069939 7:117150934-117150956 TGAGGCAAAGAGAGGAATCAAGG - Intronic
1031481837 7:122287434-122287456 GGATGCAATGTATGGATTCTGGG - Intergenic
1032281933 7:130510752-130510774 TGATACAATGAGAGGTTACAGGG + Intronic
1033162014 7:139006252-139006274 AGATCCCAAGAGAGGATTCTTGG - Intergenic
1033253851 7:139782075-139782097 TGAGACAATGAGAGGGGTCTGGG + Intronic
1034879424 7:154751944-154751966 AGATGCCAAGAGAGGGTTCTTGG + Intronic
1037180242 8:15996131-15996153 TGATGAACTGGAAGGATTCTGGG + Intergenic
1038427978 8:27477449-27477471 TGATGCAATGTTAGCATGCTTGG - Intronic
1039248213 8:35632778-35632800 TCAGGCAAGGAGAGGAGTCTAGG + Intronic
1039567581 8:38562464-38562486 TGATGTACTGAGAGGTCTCTGGG + Intergenic
1040428060 8:47309065-47309087 ATACGCAATCAGAGGATTCTGGG - Intronic
1041899937 8:62971061-62971083 TGAAGCAATGAGAGGAGTCTCGG - Intronic
1043004946 8:74807854-74807876 AGATGCCCAGAGAGGATTCTTGG - Intronic
1044402114 8:91784542-91784564 TGATGAGAAGAGAAGATTCTGGG + Intergenic
1045059014 8:98395873-98395895 TGATTCTAAGAGATGATTCTAGG + Intergenic
1046733098 8:117747282-117747304 TGATTCCATGATAGGATTATTGG + Intergenic
1047064198 8:121262271-121262293 TGATGCACTTGGAGAATTCTTGG + Intergenic
1048603337 8:135942373-135942395 CTATGCACAGAGAGGATTCTAGG - Intergenic
1049543983 8:143221095-143221117 AGTTGCAATGACAGGATTTTCGG - Intergenic
1052037084 9:23694897-23694919 TGGTGCAATGAGAGGGTGGTGGG - Intronic
1053858816 9:42364783-42364805 TTCTGCAATGAGATGATTCCAGG + Intergenic
1055660805 9:78502219-78502241 GGATGCAATGAGAAGATACAAGG - Intergenic
1186186671 X:7027061-7027083 GAATGCAATGAGAGGTTTCCAGG - Intergenic
1186744142 X:12548663-12548685 TGATTAAATGAGAATATTCTTGG + Intronic
1188798226 X:34493127-34493149 TGAAGAAATGTGAGCATTCTTGG - Intergenic
1189743119 X:44142124-44142146 AGATGCCAAGAGAGGGTTCTTGG + Intergenic
1193903756 X:87217537-87217559 AGACCCAAAGAGAGGATTCTTGG + Intergenic
1195288548 X:103409276-103409298 TGAGGCTATGAGAGGTTTTTAGG - Intergenic
1195494603 X:105515934-105515956 ATATGTAATGAGAAGATTCTGGG + Intronic
1196250227 X:113451815-113451837 TGTTCCAATGAGATGACTCTTGG + Intergenic
1196488329 X:116240071-116240093 TGACTCAATGAGAGCATTTTCGG + Intergenic
1198054963 X:132984852-132984874 TGATGCAATTTAAGGATTTTGGG - Intergenic
1198182061 X:134219959-134219981 TGCTGCAATGCCAGGCTTCTGGG + Intergenic
1198301472 X:135337948-135337970 TGATGCAATTTGAGGATTTTGGG + Intronic
1199839594 X:151631105-151631127 TGATGCTATGATAGGAATTTGGG - Intronic
1201562142 Y:15328891-15328913 GAATGCAATGAGAGGTTTCTTGG - Intergenic