ID: 993010302

View in Genome Browser
Species Human (GRCh38)
Location 5:82474911-82474933
Sequence AATTATATGCAAATATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993010302_993010304 10 Left 993010302 5:82474911-82474933 CCTTCAAATATTTGCATATAATT No data
Right 993010304 5:82474944-82474966 TATTTCCAAGACCCTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993010302 Original CRISPR AATTATATGCAAATATTTGA AGG (reversed) Intergenic
No off target data available for this crispr