ID: 993010895

View in Genome Browser
Species Human (GRCh38)
Location 5:82481231-82481253
Sequence TTTTATCTATAATCACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993010895_993010896 6 Left 993010895 5:82481231-82481253 CCTTTAGGTGATTATAGATAAAA No data
Right 993010896 5:82481260-82481282 AAAAAACTATTTCTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993010895 Original CRISPR TTTTATCTATAATCACCTAA AGG (reversed) Intergenic
No off target data available for this crispr