ID: 993018296

View in Genome Browser
Species Human (GRCh38)
Location 5:82562222-82562244
Sequence GTTTTAGGCCACCAAATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993018296_993018301 8 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018301 5:82562253-82562275 TTTGTTATCTTATGGTTCTGGGG No data
993018296_993018298 0 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018298 5:82562245-82562267 AACATAAATTTGTTATCTTATGG No data
993018296_993018302 9 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018302 5:82562254-82562276 TTGTTATCTTATGGTTCTGGGGG No data
993018296_993018303 24 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018303 5:82562269-82562291 TCTGGGGGTCAGTAGTACATCGG No data
993018296_993018299 6 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018299 5:82562251-82562273 AATTTGTTATCTTATGGTTCTGG No data
993018296_993018300 7 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018300 5:82562252-82562274 ATTTGTTATCTTATGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993018296 Original CRISPR GTTTTAGGCCACCAAATTTG TGG (reversed) Intergenic