ID: 993018297

View in Genome Browser
Species Human (GRCh38)
Location 5:82562237-82562259
Sequence TAACAAATTTATGTTGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993018297_993018304 18 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018304 5:82562278-82562300 CAGTAGTACATCGGTCTAAAAGG No data
993018297_993018299 -9 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018299 5:82562251-82562273 AATTTGTTATCTTATGGTTCTGG No data
993018297_993018306 20 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018306 5:82562280-82562302 GTAGTACATCGGTCTAAAAGGGG No data
993018297_993018301 -7 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018301 5:82562253-82562275 TTTGTTATCTTATGGTTCTGGGG No data
993018297_993018302 -6 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018302 5:82562254-82562276 TTGTTATCTTATGGTTCTGGGGG No data
993018297_993018305 19 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018305 5:82562279-82562301 AGTAGTACATCGGTCTAAAAGGG No data
993018297_993018300 -8 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018300 5:82562252-82562274 ATTTGTTATCTTATGGTTCTGGG No data
993018297_993018303 9 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018303 5:82562269-82562291 TCTGGGGGTCAGTAGTACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993018297 Original CRISPR TAACAAATTTATGTTGTTTT AGG (reversed) Intergenic