ID: 993018303

View in Genome Browser
Species Human (GRCh38)
Location 5:82562269-82562291
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993018296_993018303 24 Left 993018296 5:82562222-82562244 CCACAAATTTGGTGGCCTAAAAC No data
Right 993018303 5:82562269-82562291 TCTGGGGGTCAGTAGTACATCGG No data
993018297_993018303 9 Left 993018297 5:82562237-82562259 CCTAAAACAACATAAATTTGTTA No data
Right 993018303 5:82562269-82562291 TCTGGGGGTCAGTAGTACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr