ID: 993018717

View in Genome Browser
Species Human (GRCh38)
Location 5:82564837-82564859
Sequence CAGTGCAATCAACAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993018717_993018722 4 Left 993018717 5:82564837-82564859 CCCCCATCCTGTTGATTGCACTG No data
Right 993018722 5:82564864-82564886 ATTGCTGACCTGCATTTCTCTGG No data
993018717_993018725 9 Left 993018717 5:82564837-82564859 CCCCCATCCTGTTGATTGCACTG No data
Right 993018725 5:82564869-82564891 TGACCTGCATTTCTCTGGGGTGG No data
993018717_993018727 18 Left 993018717 5:82564837-82564859 CCCCCATCCTGTTGATTGCACTG No data
Right 993018727 5:82564878-82564900 TTTCTCTGGGGTGGAGCCCCAGG No data
993018717_993018723 5 Left 993018717 5:82564837-82564859 CCCCCATCCTGTTGATTGCACTG No data
Right 993018723 5:82564865-82564887 TTGCTGACCTGCATTTCTCTGGG No data
993018717_993018724 6 Left 993018717 5:82564837-82564859 CCCCCATCCTGTTGATTGCACTG No data
Right 993018724 5:82564866-82564888 TGCTGACCTGCATTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993018717 Original CRISPR CAGTGCAATCAACAGGATGG GGG (reversed) Intergenic
No off target data available for this crispr