ID: 993020437

View in Genome Browser
Species Human (GRCh38)
Location 5:82584831-82584853
Sequence AGCATCACTGCAGCTCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993020437_993020444 12 Left 993020437 5:82584831-82584853 CCAACTGGAGCTGCAGTGATGCT No data
Right 993020444 5:82584866-82584888 CCCCCAGAACTCAGTGTTCTTGG No data
993020437_993020446 13 Left 993020437 5:82584831-82584853 CCAACTGGAGCTGCAGTGATGCT No data
Right 993020446 5:82584867-82584889 CCCCAGAACTCAGTGTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993020437 Original CRISPR AGCATCACTGCAGCTCCAGT TGG (reversed) Intergenic
No off target data available for this crispr