ID: 993020727

View in Genome Browser
Species Human (GRCh38)
Location 5:82587146-82587168
Sequence GCCTCATGCAGAAGCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993020724_993020727 8 Left 993020724 5:82587115-82587137 CCAAATACTACAGTACAGATGGA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG 0: 1
1: 0
2: 5
3: 42
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993020727 Original CRISPR GCCTCATGCAGAAGCAGCTG TGG Intergenic
900341201 1:2190164-2190186 GCCTCCTGTAGACGCAGCCGCGG - Intronic
902045439 1:13520421-13520443 GCCTCATGCTCAAGGAGCTCAGG + Intergenic
902692871 1:18121139-18121161 GCCTCTGGCAGGAGTAGCTGAGG - Intronic
903071155 1:20727532-20727554 GGCTGGTGCAGCAGCAGCTGTGG - Exonic
903296537 1:22346861-22346883 GCCTCTTGCAGAAGCCGAAGTGG - Intergenic
903569428 1:24293601-24293623 CCCAAATGCAGAAGCTGCTGCGG - Intergenic
903680460 1:25093032-25093054 GACTCTTGCAGAAGCAGATGAGG + Intergenic
903862097 1:26370725-26370747 GCCTCAGCCACAGGCAGCTGTGG - Intronic
904050834 1:27637293-27637315 GCCCCAGGCAGAAGATGCTGAGG - Intergenic
904452651 1:30625539-30625561 GCTTGAAGCAGAAGCTGCTGGGG - Intergenic
905402901 1:37716291-37716313 CCCTTCTGCAGAAACAGCTGGGG + Exonic
906399416 1:45494150-45494172 GCCTCAAGCAGTAGAAGCTGGGG + Intronic
907409800 1:54275884-54275906 ATCTCCTGCAGAAGTAGCTGGGG - Intronic
907701074 1:56788872-56788894 GCCTCATGGAAAAGCAGCAGCGG + Intronic
907867683 1:58414283-58414305 TCATCCTGCAGAAGCAGCTCAGG + Intronic
908212197 1:61912475-61912497 GCCTCATTCCCAAGTAGCTGAGG - Intronic
909318020 1:74248048-74248070 GCCCCATGGGGAGGCAGCTGAGG + Intronic
909727953 1:78858286-78858308 GCCCAATGCAGAAAAAGCTGGGG - Intergenic
911057471 1:93720999-93721021 GCCTCAGCCAGAAGCACCTGCGG - Intronic
911143964 1:94534971-94534993 GACACAAGCAGAAGCACCTGGGG + Intronic
912694217 1:111828781-111828803 GCCTCATGCAGCAGTGGCTGGGG - Intronic
912779114 1:112527394-112527416 CCCACATGCAGAGGCAGTTGGGG - Intronic
915210560 1:154305736-154305758 GCCTCACTCAGAAGCAGCTCTGG - Intergenic
915439128 1:155933723-155933745 GGCTCCTGAAGGAGCAGCTGTGG + Exonic
915440085 1:155940513-155940535 ACCTACTGCAGAAGGAGCTGAGG - Intergenic
915635975 1:157186832-157186854 GCCTGGTGCAGAAGCTGCAGAGG - Intergenic
915789913 1:158657476-158657498 TGCTGATGAAGAAGCAGCTGGGG - Exonic
915913448 1:159928253-159928275 GCCTCCTGCAGAGGGGGCTGTGG + Exonic
916211232 1:162361596-162361618 GGCTCAGGCAGTAGCAGCAGTGG + Intronic
917490764 1:175496461-175496483 GCCATATGCAGAAGCATCTCTGG + Intronic
918101810 1:181382885-181382907 GACTCATGCAGAAGGGGCGGAGG + Intergenic
918586479 1:186194170-186194192 GTCTCATGCAGGAAAAGCTGGGG - Intergenic
920699043 1:208203942-208203964 GCTTCTTGCAGTAGCAGCTTAGG - Intronic
921596717 1:217062216-217062238 GTGTCATGCAAAACCAGCTGCGG - Intronic
922648634 1:227318180-227318202 GACACAAGCAGCAGCAGCTGCGG + Exonic
922902110 1:229145219-229145241 GGCTCTTGCAGGAGCTGCTGAGG + Intergenic
923499188 1:234550533-234550555 GCCTCCTGCACAGGCAGCGGCGG + Intergenic
1064222862 10:13456275-13456297 GGAGCATGCAGGAGCAGCTGAGG + Intronic
1064628211 10:17282978-17283000 GCCACCTGTGGAAGCAGCTGAGG + Intergenic
1066613589 10:37275465-37275487 GCCCCATGGGGAGGCAGCTGAGG + Intronic
1068241864 10:54312743-54312765 GCTCCATGCAGCATCAGCTGTGG - Intronic
1068654692 10:59562775-59562797 GCATCATGGGGAAGCAGCAGTGG + Intergenic
1070150354 10:73801387-73801409 GCGTCAGGCAGAAGGCGCTGCGG - Exonic
1070539162 10:77403761-77403783 GCCTCCTGCAGAAGACCCTGGGG + Intronic
1071189356 10:83081892-83081914 GCCTCATGCAGATGTAGATAGGG + Intergenic
1072553387 10:96495809-96495831 TCCCCAGGCAGGAGCAGCTGGGG - Intronic
1072723634 10:97797598-97797620 GCCACATGCAGAAGGAGCTGTGG + Intergenic
1072860035 10:98994231-98994253 GCAGCATGGAGAAGAAGCTGTGG + Intronic
1074060691 10:109962821-109962843 GCCCCAGGGAGAAGCAGTTGAGG - Intergenic
1075686973 10:124371120-124371142 GCCACAGCCAGAATCAGCTGGGG + Intergenic
1076845770 10:133068863-133068885 CTCTCATGCAGAAGCAGATTCGG + Intergenic
1077253564 11:1571271-1571293 GCCTGCTGCAGAGGCAGCCGCGG - Intronic
1077535424 11:3121844-3121866 GCCTCATGAGGAAGGAGCAGAGG + Intronic
1077600111 11:3568776-3568798 GCCCCTTGCAGAAGGAGCTGAGG + Intergenic
1077797477 11:5507718-5507740 GCCTCAGGCTGCAGCTGCTGGGG + Exonic
1078436151 11:11327608-11327630 GCCTCCTGCAGACCCAGCAGTGG + Intronic
1079668292 11:23134978-23135000 GTTTGATGCAGAAGCACCTGTGG - Intergenic
1080866317 11:36198579-36198601 GCTTCATGCAGAGGCAGGAGTGG - Intronic
1080873817 11:36259265-36259287 CCAGCATGCAGGAGCAGCTGGGG + Intergenic
1081046383 11:38278740-38278762 GCCCCGTGGGGAAGCAGCTGAGG + Intergenic
1082890975 11:58138252-58138274 GCCTCAGGCAGCCCCAGCTGGGG - Intronic
1083600572 11:63945054-63945076 ACCTGATCTAGAAGCAGCTGTGG + Intronic
1084256027 11:67943393-67943415 GCCCCTTGCAGAAGGAGCTGGGG + Intergenic
1084816732 11:71651917-71651939 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
1085170431 11:74445172-74445194 GCCTCAGGCAGCAGCACCTTTGG + Intergenic
1085238026 11:75030333-75030355 GCCTGGTGCAGAAGCTGGTGGGG + Intergenic
1085300607 11:75456174-75456196 GTCTCATGTAGCAGAAGCTGAGG + Intronic
1085777993 11:79383257-79383279 GCCTGATGGAGAGGCTGCTGTGG - Intronic
1089109689 11:116045494-116045516 GCCTCATCCTGAAGGATCTGGGG - Intergenic
1089166850 11:116483948-116483970 GCCTCATACAGAGATAGCTGTGG - Intergenic
1090106227 11:123855465-123855487 GCCTCCTGCAGATGCAGGAGAGG + Intergenic
1090586167 11:128215412-128215434 GCCCCATGGAGAGGCAGCTGAGG + Intergenic
1091078466 11:132643305-132643327 GCCTCTTGCTGAAGGAGCTCAGG + Intronic
1091111461 11:132972812-132972834 GCCTCAAGCAGAGGGAGCAGGGG - Intronic
1092113666 12:5982889-5982911 GGTTTATGAAGAAGCAGCTGGGG - Intronic
1092426257 12:8378136-8378158 GACCCTTGCAGAAGGAGCTGGGG + Intergenic
1094833216 12:34309911-34309933 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1097159916 12:57038823-57038845 GGCAGATGCGGAAGCAGCTGAGG + Exonic
1097253702 12:57655986-57656008 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1097580700 12:61453397-61453419 GCCTCATGAAGAAGAAACTGAGG - Intergenic
1097646405 12:62239803-62239825 GCTTCATGCAGCATCAGATGGGG - Intronic
1099947501 12:89261323-89261345 GCCTCAAGCATAACCAGATGAGG + Intergenic
1099957891 12:89368907-89368929 GCCTCCTGCGGAAGAAGCTGGGG - Intergenic
1100340090 12:93670493-93670515 GCCTCATTAAGATGCAGCAGAGG + Intergenic
1101066498 12:101027366-101027388 GCAGCAGGCAGCAGCAGCTGTGG - Intronic
1102507367 12:113392210-113392232 GCTGAAGGCAGAAGCAGCTGGGG - Intergenic
1102986188 12:117280580-117280602 GCCTGATGGAGAAGCAGGTTTGG + Intronic
1104042622 12:125140244-125140266 GCCTCATGCAGGAGCTGGTGTGG + Intronic
1104825877 12:131709426-131709448 GCAGCATGCAGAAGCAGAAGAGG + Intergenic
1104910399 12:132237633-132237655 ATCTCCTGCAGAGGCAGCTGTGG - Intronic
1105645347 13:22312116-22312138 GCCCCAGCCAGAAGCAGCTGGGG - Intergenic
1106782693 13:33075451-33075473 GGCTGCTGCAGAATCAGCTGAGG - Intergenic
1108959375 13:56204583-56204605 GTCACATTCAGAAGCAGCAGAGG + Intergenic
1109243267 13:59918556-59918578 GCCTGATGCAGGGCCAGCTGTGG + Intronic
1111470533 13:88674961-88674983 GCCTCATGCTGAATCAAATGTGG - Intergenic
1113917827 13:113884584-113884606 GCCTCCTGCTGAAACAGCAGAGG - Intergenic
1114155567 14:20099417-20099439 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1114679582 14:24473328-24473350 GCCCCACGGAGAGGCAGCTGAGG - Intergenic
1115930729 14:38490154-38490176 GCATCTTGCAAAAGAAGCTGGGG + Intergenic
1115934376 14:38535247-38535269 GCCTCAAGCACAAGAAACTGTGG + Intergenic
1116916608 14:50532147-50532169 CCCTCGTGCAGACGGAGCTGCGG - Exonic
1117497974 14:56324616-56324638 GTCCCATGCAGATGTAGCTGTGG - Intergenic
1117714039 14:58562749-58562771 GCCTCAGAGAGGAGCAGCTGGGG + Intergenic
1117902692 14:60551373-60551395 GCATCATGCTGCAGCAGCTTGGG + Intergenic
1118647470 14:67853350-67853372 TCCTAAAGCAGAAGCAGCAGAGG - Intronic
1121917948 14:97853452-97853474 GCCTCCTGCAGATGTAGCTTTGG + Intergenic
1122964460 14:105115541-105115563 GCCTCTAGCAGAAGAAGGTGAGG + Intergenic
1125524679 15:40367536-40367558 GCCTCAAGCAGGAGCTGCTGAGG + Exonic
1126332470 15:47548283-47548305 GCAGCATGGAGAGGCAGCTGTGG + Intronic
1126908939 15:53398560-53398582 GCCTCAACAAGAAGTAGCTGAGG - Intergenic
1128087723 15:64897430-64897452 GCCTTCTGCAGGGGCAGCTGAGG - Intronic
1129034244 15:72640087-72640109 GCCCCTTGCAGAAGCACTTGCGG + Intergenic
1129154131 15:73707201-73707223 GCCTCCTGCAGAAGCTGCTGAGG + Intronic
1129215638 15:74097129-74097151 GCCCCTTGCAGAAGCACTTGCGG - Intergenic
1129330289 15:74823651-74823673 GCCTCCTGCAGGAGGAGCTTCGG + Exonic
1129409161 15:75339306-75339328 GCCCCTTGCAGAAGCACTTGCGG + Exonic
1129667815 15:77589219-77589241 GCCCCCTGCAGAGGCAGCAGGGG + Intergenic
1129732773 15:77941458-77941480 GCCCCTTGCAGAAGCACTTGCGG - Intergenic
1129899950 15:79139323-79139345 GCTTGATGCAGAAGCAGATATGG - Intergenic
1132091879 15:98953942-98953964 GCCTCAGCCAGGAGCGGCTGTGG - Intronic
1132343148 15:101090636-101090658 GCCACATGCAGAGGCTGTTGTGG + Intergenic
1132735081 16:1381842-1381864 GGCTGATGCAGAAGCATCTCTGG + Intronic
1133302461 16:4790973-4790995 GCCTCTCCCATAAGCAGCTGAGG + Intronic
1133372074 16:5252780-5252802 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
1134139552 16:11706257-11706279 GCCACCTGCATGAGCAGCTGTGG - Intronic
1136144821 16:28310321-28310343 TCCACTTGCAGGAGCAGCTGTGG - Intronic
1136293539 16:29289691-29289713 GCCCCTTGCAGCAGCAGCAGTGG + Intergenic
1136366018 16:29809666-29809688 GCCACATGCAGACCCATCTGGGG + Exonic
1136555552 16:31005818-31005840 GCCCCTTCCAGAAGCACCTGGGG + Intronic
1137721183 16:50628392-50628414 CCCACAGGCTGAAGCAGCTGAGG - Intronic
1137748500 16:50841230-50841252 GGCGCATGCAGAAGCAGCCGCGG + Intergenic
1137945712 16:52731628-52731650 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1139273253 16:65703218-65703240 GCCTTCTGCATTAGCAGCTGAGG + Intergenic
1139472368 16:67185041-67185063 GCCTCAGCCAGCAGCAGCTGCGG + Exonic
1140814977 16:78613094-78613116 GCCCCATGCAAGAGAAGCTGAGG - Intronic
1141032840 16:80604451-80604473 GCCTCATGCTCAAGCAGCTCTGG - Exonic
1141134069 16:81454423-81454445 GCCTCCTGCAGAAACATCTTAGG + Intronic
1141409257 16:83821362-83821384 ACCTCATGCAAAGACAGCTGGGG - Intergenic
1142099423 16:88263697-88263719 GCCCCTTGCAGCAGCAGCAGGGG + Intergenic
1142345279 16:89550057-89550079 GCCTCTTGGAGCTGCAGCTGCGG - Intronic
1142801876 17:2351391-2351413 CCCTCATGCAGACGAAGCTCTGG + Intronic
1142973027 17:3625627-3625649 CCACCATGCAGAAGCAGCAGTGG + Intronic
1143188283 17:5023661-5023683 GGCTCAAGCAGGAGCAGCTACGG + Exonic
1143251203 17:5524555-5524577 GCCTCTTGGAGAAGCAACTGGGG - Intronic
1143380005 17:6490151-6490173 GCCTCATTCAGTAGCACCTGGGG + Intronic
1144139934 17:12338283-12338305 GCCTCTTGCAGAAGGAGAAGGGG + Intergenic
1144339063 17:14297803-14297825 GCCGCAGGCTGGAGCAGCTGCGG + Intergenic
1144384479 17:14736695-14736717 CCCTCCAGCAGAAGCAGCGGTGG - Intergenic
1144675872 17:17161286-17161308 GGCTCCTGCAGGACCAGCTGAGG + Exonic
1144738060 17:17565938-17565960 GCTCCAAGGAGAAGCAGCTGCGG - Intronic
1144782083 17:17813463-17813485 GCCTCATGTAGGAACACCTGGGG + Exonic
1146197313 17:30824605-30824627 GCCTCCTGCAACAGCAGCTCAGG + Exonic
1147167824 17:38602798-38602820 GGCACATGAAGAGGCAGCTGTGG - Intronic
1147458721 17:40554820-40554842 GCCTCAGCCAGGAGCAGCTCCGG - Exonic
1147976359 17:44250340-44250362 TCCTCCTGGAGCAGCAGCTGAGG - Exonic
1149313376 17:55417679-55417701 ACCTCAGTCAGAAGTAGCTGGGG - Intronic
1151217509 17:72587688-72587710 GCCACAGACAGAAGCAGCAGTGG + Intergenic
1151983143 17:77526188-77526210 GCCTCATGGGGAGGCAGCTGAGG + Intergenic
1152820898 17:82437171-82437193 TCCTCATGCAGAAGTACCGGCGG + Exonic
1153380573 18:4434616-4434638 GCCTCTTGCAGGACCAGCAGAGG - Intronic
1153394410 18:4602358-4602380 GGCAGATTCAGAAGCAGCTGTGG - Intergenic
1153684224 18:7529138-7529160 CAGTCATGGAGAAGCAGCTGCGG + Intergenic
1156450305 18:37262880-37262902 GCCTCACGCTGCTGCAGCTGAGG - Intronic
1157598370 18:48877686-48877708 TGCTCCTGAAGAAGCAGCTGTGG - Intergenic
1157880059 18:51313031-51313053 GGCTCAGGCAGGAGCTGCTGCGG - Intergenic
1158390861 18:57043842-57043864 GCCTCATCTGGAAGCTGCTGTGG - Intergenic
1158914142 18:62103410-62103432 CCCTCAGCCAGGAGCAGCTGAGG - Intronic
1159914431 18:74176029-74176051 GCCTCCAGCATCAGCAGCTGTGG + Intergenic
1160462837 18:79052448-79052470 GCCTCAGCCAAAAGCAGCAGGGG - Intergenic
1160950675 19:1665781-1665803 GCCTGATGGAGCAGGAGCTGGGG - Intergenic
1161976074 19:7608243-7608265 CCCTCAAGTCGAAGCAGCTGGGG - Exonic
1162833953 19:13303933-13303955 GCCCCTTGGAGATGCAGCTGTGG + Intronic
1162853637 19:13451210-13451232 GCCTCTCACAGAAGGAGCTGTGG - Intronic
1163385587 19:16997992-16998014 TCCTCATTCAGAAAGAGCTGTGG + Intronic
1163423229 19:17226767-17226789 GCCTCCGGGAGAAGCAGCTCAGG - Exonic
1163713010 19:18857991-18858013 GACTCTTGCAGAAGCACCAGGGG - Intronic
1163756715 19:19110839-19110861 ACCTCATGCAGATCCTGCTGCGG + Exonic
1163948535 19:20563185-20563207 CCCACAGGCAGATGCAGCTGAGG - Intronic
1164466185 19:28489431-28489453 GCCCCATCCACCAGCAGCTGAGG + Intergenic
1165383029 19:35494467-35494489 GCCTCATCCACCAGCAGGTGTGG + Intronic
1166101939 19:40576370-40576392 GCCGCCTGGAGAAGCCGCTGGGG + Exonic
1167216954 19:48171147-48171169 GCCACATGCAGCTGTAGCTGGGG - Intronic
1167476497 19:49704614-49704636 GCCTGACGCAGGAGCATCTGGGG + Intronic
1167509856 19:49890339-49890361 GCCACATGCAGGAGGCGCTGCGG - Exonic
1168274531 19:55270004-55270026 GCCTCGGGCAGCAGGAGCTGAGG + Intronic
925926027 2:8671324-8671346 GCTTAGTGCAGAAGCAGGTGAGG + Intergenic
926163376 2:10503389-10503411 ACCTCAGACAGAGGCAGCTGAGG - Intergenic
926243053 2:11102777-11102799 GCTTCAAGAAGCAGCAGCTGCGG + Intergenic
927904726 2:26848315-26848337 GCCTCACGCAGAAACAGAAGGGG - Intronic
928207383 2:29295808-29295830 GTCTCAGGCAGAGGCTGCTGTGG + Intronic
930553715 2:52869194-52869216 GGCACATTCAGAAGCAGCAGAGG - Intergenic
931118440 2:59190039-59190061 GCTTCAATCAGAAACAGCTGTGG - Intergenic
931168332 2:59775567-59775589 GTCTGAGGCAGAAGCACCTGGGG + Intergenic
931640160 2:64374813-64374835 GACAGATGAAGAAGCAGCTGAGG + Intergenic
933572632 2:84031165-84031187 GCCTCCCGCAGCAGCAGCTTAGG - Intergenic
934932208 2:98435822-98435844 GCCTTATGCAGATGCAGATAGGG + Intergenic
935211572 2:100943507-100943529 GCCTCATCCAGTGTCAGCTGTGG - Intronic
935473882 2:103494265-103494287 GCCTCCTACAGCAGCAGCTCAGG - Intergenic
935811070 2:106797679-106797701 GGCTCATGCAGAGGCTGCAGTGG + Intergenic
937269891 2:120642804-120642826 GCTCCATTCAGCAGCAGCTGGGG + Intergenic
937903837 2:127042087-127042109 CCCTCCTCAAGAAGCAGCTGTGG - Intergenic
937957033 2:127427309-127427331 GCCTCTTGCTTAAGCACCTGGGG - Intronic
938252944 2:129829850-129829872 GGCTCTTGCTGATGCAGCTGAGG - Intergenic
938264012 2:129913509-129913531 GCCCCATACAGAAGCCGCTTGGG + Intergenic
939117726 2:138079903-138079925 GCCCCATCCTGAAGCAGCTAGGG - Intergenic
942463925 2:176188823-176188845 GTGTCATGCAGCAGCAGCGGCGG + Exonic
942824912 2:180163964-180163986 GCCTGAAACATAAGCAGCTGTGG + Intergenic
943947851 2:194090531-194090553 GCCTTATGGGGAGGCAGCTGAGG + Intergenic
945869164 2:215208093-215208115 GCCTCGTGGGGAGGCAGCTGAGG - Intergenic
948808300 2:240462403-240462425 TCATCAGGCAGCAGCAGCTGGGG - Exonic
1169066413 20:2696594-2696616 GCATCATGCAGAGGAGGCTGGGG - Intronic
1170476001 20:16715098-16715120 GCCTCATGCAAGAGAAGATGAGG + Intergenic
1172156045 20:32825469-32825491 GCCTCATGGGGAAGAAGGTGAGG + Intronic
1172435480 20:34926154-34926176 GGCTGTTGCAGAGGCAGCTGTGG + Exonic
1172973098 20:38887904-38887926 GCCTCATGAGGATGGAGCTGAGG + Intronic
1173701982 20:45080439-45080461 GCTTCGTGCAGCAGCAGATGAGG - Intergenic
1174114211 20:48215758-48215780 GCCTCGGGAAGGAGCAGCTGGGG - Intergenic
1174172834 20:48627855-48627877 ACATCATGCGGAAGCAGGTGAGG - Exonic
1175305688 20:57974091-57974113 GCCTCAGGCAGGACAAGCTGTGG - Intergenic
1175475491 20:59270724-59270746 GGTTCAATCAGAAGCAGCTGAGG - Intergenic
1175732580 20:61364176-61364198 GGCTCATCCAGTAGGAGCTGAGG + Intronic
1176671058 21:9735758-9735780 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1176906019 21:14502578-14502600 ACCTCAGGCAGCAGCAGCAGTGG + Intronic
1179173048 21:38987865-38987887 GCCAAATGCTGAAGCAGCAGGGG + Intergenic
1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG + Intronic
1179549919 21:42137446-42137468 TCCTCATGCAGAAGCAGGCCTGG + Exonic
1179729794 21:43361284-43361306 GCCCCACCCACAAGCAGCTGCGG + Intergenic
1179791017 21:43755978-43756000 GCCCCATGCAGCTGGAGCTGCGG + Exonic
1183623369 22:38987358-38987380 GGCCCATTCAGAAGCAGCAGTGG - Intronic
1183628971 22:39021710-39021732 GGCCCATTCAGAAGCAGCAGTGG - Intronic
1183630179 22:39027815-39027837 GGCCCATTCAGAAGCAGCAGTGG - Intronic
1183638218 22:39077555-39077577 GGCCCATTCAGAAGCAGCAGTGG - Intronic
1183752457 22:39729438-39729460 GTCACATGCAGAGGCACCTGGGG - Intergenic
1183780343 22:39995188-39995210 GGCTCAAGGAGGAGCAGCTGCGG + Exonic
1184032244 22:41901957-41901979 GCATGCTGCAGAAGCACCTGTGG - Intronic
1184032805 22:41904857-41904879 GCTTCATGCAGGAACACCTGGGG - Exonic
1184296255 22:43527340-43527362 GTCACATGGAGGAGCAGCTGGGG + Intergenic
1184533234 22:45070276-45070298 GAATGAGGCAGAAGCAGCTGGGG + Intergenic
1184554892 22:45227813-45227835 CCCTAAAGCAGAAGCAGCTCCGG + Intronic
1185395714 22:50586618-50586640 GCGTCATGCAGAAGGAGCACAGG + Intronic
949874661 3:8618372-8618394 GCCTCATGCAGGAACAGCAGGGG - Intergenic
950103750 3:10375379-10375401 GGCTGATGCAGCTGCAGCTGAGG - Intronic
950261534 3:11545835-11545857 GCCTCCTGCAGAAGAAGTGGGGG + Intronic
950858335 3:16126054-16126076 CACTCATGCACAACCAGCTGGGG + Intergenic
951743139 3:25946103-25946125 GCTCCATGCAGCACCAGCTGGGG - Intergenic
952342564 3:32458151-32458173 GCCCCAGGGAGGAGCAGCTGCGG + Intronic
952901849 3:38116148-38116170 GCCGGAAGGAGAAGCAGCTGTGG + Intronic
953297043 3:41729426-41729448 GCATTATGCAGTAGCAGCTTGGG - Intronic
953626835 3:44578920-44578942 GGCTCCTGCAGGACCAGCTGAGG - Intronic
953777296 3:45831545-45831567 ACCTCAGTCAGAAGCATCTGTGG - Intronic
953800693 3:46020453-46020475 GCCTCATCCAGCAGTACCTGAGG + Exonic
953878478 3:46679532-46679554 GCTTCCTGAAGAAGCCGCTGGGG - Intronic
954089306 3:48272063-48272085 GCCTCATGGGGAGGCGGCTGAGG + Intronic
954803515 3:53201473-53201495 GCAGCATGCAGCAGCAGCAGAGG - Intergenic
955777942 3:62453666-62453688 GCCCCAGGCAGAAGCCACTGAGG - Intronic
957070937 3:75567426-75567448 GTCCCTTGCAGAAGGAGCTGGGG + Intergenic
958907720 3:99960401-99960423 GCCTAATTGAGGAGCAGCTGTGG - Intronic
959109318 3:102102960-102102982 GCCTCAAGAATAAGCACCTGAGG - Intronic
959648668 3:108730501-108730523 ACATGTTGCAGAAGCAGCTGAGG - Intergenic
961038769 3:123662316-123662338 GCCTTATGCAGGAGAAACTGAGG - Intronic
961283182 3:125779297-125779319 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
961324895 3:126104198-126104220 GCTTGATGCAGACGTAGCTGGGG - Intronic
961785855 3:129346235-129346257 GCCTCATCCACAAGAACCTGGGG + Intergenic
962383746 3:134916501-134916523 GCCCCGTGCAGAGGCAGCTAAGG + Intronic
963879651 3:150514708-150514730 GCATCCTGCAGAAACAACTGGGG + Intergenic
964307213 3:155354892-155354914 ACCTGATGCAGAACCAGCTCAGG + Intergenic
964333645 3:155631814-155631836 GAATAATGCAGAAGCACCTGTGG + Intronic
964336318 3:155658416-155658438 ACCTCAAGAAGCAGCAGCTGCGG + Intronic
964619322 3:158705274-158705296 GTCTCAGGGAGAAGCAGCTCAGG - Intronic
966863094 3:184241484-184241506 GCCTCCTGCAGCCGCACCTGAGG - Exonic
966998674 3:185310504-185310526 GCCTCATGCATGAACAGTTGGGG + Intronic
968520677 4:1033446-1033468 GCTTCAGGCAGCAGCAGCTGTGG + Intergenic
968689818 4:1984669-1984691 GCCTCAGCCAGAATCTGCTGGGG - Intronic
969014542 4:4095117-4095139 GACCCTTGCAGAAGGAGCTGGGG + Intergenic
969323044 4:6424618-6424640 GCCTCCTCCAGAGGCGGCTGTGG + Intronic
969739410 4:9013322-9013344 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
969798591 4:9544837-9544859 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
972168980 4:36321913-36321935 ACCTAAAGCAGAAGCAGGTGTGG - Intronic
972890491 4:43551434-43551456 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
973040210 4:45460326-45460348 GCCTTATGCAGATGTAGATGGGG + Intergenic
974709702 4:65574108-65574130 ACTTCAAGAAGAAGCAGCTGCGG + Intronic
977339202 4:95736149-95736171 TCCTCATGCAGATGCAGCAAGGG + Intergenic
977883615 4:102234558-102234580 GCCTCATGGGGAGGCAGCTGAGG - Intergenic
978885586 4:113762420-113762442 GCCCCTTGCAGAAGGGGCTGCGG - Intergenic
979609034 4:122670436-122670458 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
982245095 4:153343568-153343590 GCCTCCAGCAGAAGCAACAGGGG + Intergenic
982306207 4:153933857-153933879 CTCACATCCAGAAGCAGCTGGGG - Intergenic
982323682 4:154107561-154107583 CCCTCATGCAGAAGCCTGTGTGG + Intergenic
985070011 4:186158523-186158545 GCCTGCTGCTGATGCAGCTGTGG + Intronic
985844877 5:2336618-2336640 GCCTCCTGCCGAGGCTGCTGTGG - Intergenic
985903097 5:2812596-2812618 GCCTCGTGCAGAGGCTTCTGTGG + Intergenic
986759415 5:10866438-10866460 GCATCTTACAGAAGCATCTGTGG - Intergenic
987109730 5:14674331-14674353 GCCTCATGCAGGAGCTGCATAGG + Intronic
987401584 5:17483208-17483230 GCCTGATGCAAAAGCAATTGAGG + Intergenic
988078988 5:26391689-26391711 GACTCATGCAGAAGTAGGAGTGG + Intergenic
989348332 5:40454263-40454285 GAATCCTGCAGAAGCAACTGAGG - Intergenic
989678346 5:43999549-43999571 GCCACATGCAGTCACAGCTGAGG - Intergenic
991301931 5:65136985-65137007 GACACATGCAGAAGAGGCTGAGG - Intergenic
991547619 5:67800812-67800834 ACCGCCTGCAGAAGCAGATGAGG + Intergenic
992353132 5:75951648-75951670 GCCTCATGCAGAAGAAATTCGGG + Intergenic
992860539 5:80904740-80904762 GCTCCATGCATGAGCAGCTGGGG - Intergenic
993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG + Intergenic
994451403 5:99949537-99949559 GCTTCATGCAGCAGCAGCTCAGG + Intergenic
996575878 5:124976254-124976276 GGCCCATGGGGAAGCAGCTGAGG + Intergenic
997158177 5:131580173-131580195 GCCCCATGGAGAGGCAGCTGAGG + Intronic
997429618 5:133828603-133828625 GCCTGATGCAGAATTGGCTGAGG - Intergenic
997691576 5:135831011-135831033 TCCTCATGCAGAAGATGCTTTGG + Intergenic
998881022 5:146645061-146645083 CCCACATTCAAAAGCAGCTGAGG + Intronic
1000393518 5:160749377-160749399 GCCACAGGAAGAAGGAGCTGGGG + Intronic
1001406502 5:171480873-171480895 GCCTCTTGCAGAAAAACCTGCGG - Intergenic
1003591625 6:7441426-7441448 GCCCCATGGGGAAGCAGCTAAGG - Intergenic
1003611512 6:7618678-7618700 GCCTCCTACAGAAGCAAGTGGGG + Intergenic
1004997799 6:21210948-21210970 GCTTCATGAGGAAGCAGATGGGG - Intronic
1006093078 6:31639606-31639628 GCCTCTGAGAGAAGCAGCTGGGG + Exonic
1006231418 6:32590340-32590362 GCCTCAAGGAGCAGCAGCTCCGG + Intergenic
1008407796 6:51138346-51138368 GCATCATTCAAATGCAGCTGTGG + Intergenic
1008906354 6:56681501-56681523 CCCTGAGGCAGAATCAGCTGGGG - Intronic
1010269363 6:73903379-73903401 GCCCCATGGAGAGGCGGCTGAGG - Intergenic
1011029004 6:82900729-82900751 CCCTCATGCACAAGCAGCCCTGG - Intronic
1011410315 6:87059933-87059955 GCCCCATGAGGAGGCAGCTGAGG + Intergenic
1012394470 6:98780457-98780479 ACTTCAAGAAGAAGCAGCTGAGG - Intergenic
1012705876 6:102529295-102529317 GCCTCATGCAGAGGGATCAGGGG + Intergenic
1013296731 6:108764451-108764473 GCCTCATGAACAAGAACCTGTGG - Intergenic
1013316062 6:108944290-108944312 GCCTTTTGCACAGGCAGCTGAGG + Intronic
1013317399 6:108955882-108955904 GACTGCTGCAGAATCAGCTGTGG + Intronic
1013806377 6:114000348-114000370 GCCTCATGCAGGGGTTGCTGTGG - Intronic
1016781184 6:147960470-147960492 GCCTTAGGTAGAAGCAGCTGTGG + Intergenic
1017727137 6:157283660-157283682 GCCTGAATCAGAATCAGCTGGGG - Intergenic
1018024888 6:159797308-159797330 GCATCATGTAGAAGCACTTGTGG + Exonic
1018389732 6:163332740-163332762 GCCTCATCATGAAGCAGATGTGG - Intergenic
1019146869 6:169981315-169981337 CCCTCATCCAGCAGCCGCTGGGG + Intergenic
1019174602 6:170153808-170153830 GCCTCCTGCAGATGGAGATGAGG - Intergenic
1019656083 7:2196833-2196855 GCCTCATGGAGTAGGAGCCGTGG - Intronic
1022588717 7:31640997-31641019 GCCTCAGGCTGAGGTAGCTGGGG + Intronic
1022691879 7:32664058-32664080 GCCACAGGCAGAAGCAGCTGAGG + Intergenic
1022919541 7:34998599-34998621 GCCACAGGCAGAAGCAGCTGAGG + Intronic
1023851605 7:44153259-44153281 TCCTCATCCAGAAGCAGCTGTGG - Intronic
1025194337 7:56920948-56920970 GTCTGATGCAGCAGCAGCTTTGG - Intergenic
1025234640 7:57226463-57226485 GCCTCATACATAAGCAGGTTCGG - Intergenic
1025677615 7:63656005-63656027 GTCTGATGCAGCAGCAGCTTTGG + Intergenic
1028547336 7:92018097-92018119 GCCTCATCCAAAAGGAGCGGCGG + Intronic
1028796571 7:94908906-94908928 CCCTCACGCACAATCAGCTGAGG - Intronic
1029037939 7:97541431-97541453 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1029694901 7:102206165-102206187 CCCTCATACAGATGCAGCCGGGG + Intronic
1029985703 7:104921348-104921370 GCCAAATCCAGAAACAGCTGTGG + Intergenic
1032454061 7:132058503-132058525 TCCTCATGCAGAAACTGCTAGGG + Intergenic
1033300008 7:140177012-140177034 GCCTCCTGCAGCAGCCGCGGCGG + Exonic
1033335829 7:140451601-140451623 GCCTGTTGCAAAAGAAGCTGAGG - Intergenic
1034591173 7:152140725-152140747 GCTTCATGAGGATGCAGCTGGGG - Intronic
1034879685 7:154753650-154753672 GCCTGAAGCAGAAGTCGCTGTGG - Intronic
1035325434 7:158062792-158062814 GCCCCATGGGGAGGCAGCTGAGG - Intronic
1035783028 8:2243888-2243910 GCCACGTGCAGAAGCACCTGTGG - Intergenic
1035809099 8:2475698-2475720 GCCACGTGCAGAAGCACCTGTGG + Intergenic
1036244474 8:7104548-7104570 GCCCCTTGCAGAAAGAGCTGGGG - Intergenic
1036256265 8:7209194-7209216 GCCCCTTGCAGAAGGAGCTTGGG + Intergenic
1036308316 8:7667778-7667800 GCCCCTTGCAGAAGGAGCTGGGG + Intergenic
1036361219 8:8078300-8078322 GCCCCTTGCAGAAGGAGCTGGGG - Intergenic
1036889757 8:12588703-12588725 GCCCCTTGCAGAAGGAGCTGGGG + Intergenic
1036897359 8:12646855-12646877 GCCCCGTGCAGAAGGAGCTGGGG + Intergenic
1037901834 8:22693179-22693201 GCCTCATACCGCACCAGCTGAGG - Exonic
1038175719 8:25180943-25180965 GCCACATGGAGAAGTTGCTGAGG + Intergenic
1039093661 8:33859556-33859578 ACTTCAGGAAGAAGCAGCTGCGG - Intergenic
1039111391 8:34044032-34044054 GCCTTATGCAGATGTAGATGGGG - Intergenic
1039240369 8:35549521-35549543 GCAGCAGTCAGAAGCAGCTGTGG + Intronic
1039966500 8:42287962-42287984 GCCTAATACAGCAGCAGCCGGGG + Intronic
1041856194 8:62458173-62458195 GCCTGTTTCAGAAGCAGCTGGGG - Intronic
1042904112 8:73756130-73756152 GCCCCATGCAGTATCAGCTAAGG + Intronic
1042932659 8:74029216-74029238 GCATCATGCAGAGCCACCTGGGG + Intergenic
1045506395 8:102781754-102781776 GGCTCCTGCAGAAGCAGATGGGG - Intergenic
1047302313 8:123624147-123624169 GCTCCATGCAGCATCAGCTGGGG + Intergenic
1048481747 8:134802456-134802478 GACTCATGTAGAAGGAACTGAGG + Intergenic
1048898515 8:139016217-139016239 TCCTCATGCAGAAGCTGCTCGGG + Intergenic
1049080482 8:140439152-140439174 GCCGCATGCGGAAGCACGTGGGG - Exonic
1049447250 8:142636924-142636946 GCCTCAGACAGAGGAAGCTGGGG - Intergenic
1049525736 8:143125961-143125983 GCCACTGGAAGAAGCAGCTGGGG + Intergenic
1049762330 8:144337049-144337071 GCCGCAGGCAGAGGCGGCTGCGG - Intergenic
1049973641 9:842108-842130 GCCACATGCAGAAGCGCTTGTGG - Exonic
1051618942 9:19032778-19032800 GCCGCCTGATGAAGCAGCTGGGG + Intronic
1052916431 9:33927136-33927158 GCCTCCTCCTGAAGCAGCTGAGG - Intronic
1053129985 9:35609311-35609333 GCCACAGCCAGAGGCAGCTGGGG - Exonic
1054461520 9:65467744-65467766 AACTCATGCAGAGCCAGCTGTGG + Intergenic
1054989652 9:71308769-71308791 GTCTCAGCCAGAAGCAACTGTGG - Intronic
1057141964 9:92731871-92731893 TCCTGATGCACAGGCAGCTGGGG + Intronic
1057205102 9:93167118-93167140 GCCCCAGGCAGGAACAGCTGAGG + Intergenic
1058365200 9:104200815-104200837 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1058413450 9:104760761-104760783 GGCTCATGCAAAAGCAGGAGAGG - Intergenic
1059547526 9:115193177-115193199 TCCCCATTCTGAAGCAGCTGTGG + Intronic
1060526013 9:124321759-124321781 GCCTCCAGCAACAGCAGCTGGGG - Intronic
1060783408 9:126430421-126430443 GCCTGATGGAGAGGCAGCTTGGG - Intronic
1060790565 9:126482945-126482967 GCCTCCTGGCGATGCAGCTGCGG - Intronic
1060804060 9:126563921-126563943 GCCTCAGGGAGCAGCAGGTGTGG + Intergenic
1061951834 9:133940562-133940584 GCCTGAGGCAGAAGGGGCTGGGG - Intronic
1062279678 9:135746411-135746433 GCCTCAAAGAGAAGCTGCTGGGG + Intronic
1185845439 X:3433397-3433419 CCATCTTGCAGACGCAGCTGTGG + Intergenic
1186195697 X:7108632-7108654 GGCACCTGCAGATGCAGCTGTGG - Intronic
1186799518 X:13078998-13079020 AGCTCATGCAGAGGCTGCTGAGG + Intergenic
1187823599 X:23313458-23313480 GCCGCATGTAAGAGCAGCTGGGG - Intergenic
1189479303 X:41380785-41380807 GCCTCATGCTGAAGCTTCAGGGG + Intergenic
1190470250 X:50771262-50771284 AACTCAGGCAGAAGCAGCTTGGG + Intronic
1191178784 X:57537196-57537218 ACCTGTTGCAGCAGCAGCTGGGG + Intergenic
1192434260 X:71133168-71133190 GCCTCATGCATAAGCTGCTTTGG - Exonic
1197069062 X:122271459-122271481 GCAACATGCACAATCAGCTGTGG - Intergenic
1198672783 X:139099315-139099337 GCCTCAGACAGAACCAGTTGTGG - Intronic
1200873619 Y:8128658-8128680 GCCGCATGGGGAAGCAGCTAAGG + Intergenic