ID: 993021136

View in Genome Browser
Species Human (GRCh38)
Location 5:82592477-82592499
Sequence GAGGAGGAGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993021136_993021146 9 Left 993021136 5:82592477-82592499 CCTTCCTCCTTCTCCTCCTCCTC No data
Right 993021146 5:82592509-82592531 ATTATTCTTTCTTTTTTTTGGGG No data
993021136_993021145 8 Left 993021136 5:82592477-82592499 CCTTCCTCCTTCTCCTCCTCCTC No data
Right 993021145 5:82592508-82592530 TATTATTCTTTCTTTTTTTTGGG No data
993021136_993021144 7 Left 993021136 5:82592477-82592499 CCTTCCTCCTTCTCCTCCTCCTC No data
Right 993021144 5:82592507-82592529 TTATTATTCTTTCTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993021136 Original CRISPR GAGGAGGAGGAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr