ID: 993021804

View in Genome Browser
Species Human (GRCh38)
Location 5:82601062-82601084
Sequence CTAATATTCTAGGAAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993021804_993021808 9 Left 993021804 5:82601062-82601084 CCCACACCTTCCTAGAATATTAG No data
Right 993021808 5:82601094-82601116 AGTTTTCTTACTTAAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993021804 Original CRISPR CTAATATTCTAGGAAGGTGT GGG (reversed) Intergenic
No off target data available for this crispr