ID: 993034843

View in Genome Browser
Species Human (GRCh38)
Location 5:82745452-82745474
Sequence AGGTACTCCTAGCATCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034843_993034852 26 Left 993034843 5:82745452-82745474 CCTACTGGATGCTAGGAGTACCT No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034843_993034846 1 Left 993034843 5:82745452-82745474 CCTACTGGATGCTAGGAGTACCT No data
Right 993034846 5:82745476-82745498 CCCATCCTTACCCTCCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034843 Original CRISPR AGGTACTCCTAGCATCCAGT AGG (reversed) Intergenic
No off target data available for this crispr