ID: 993034844

View in Genome Browser
Species Human (GRCh38)
Location 5:82745472-82745494
Sequence AGTGGAGGGTAAGGATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034844_993034852 6 Left 993034844 5:82745472-82745494 CCTTCCCATCCTTACCCTCCACT No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034844_993034854 11 Left 993034844 5:82745472-82745494 CCTTCCCATCCTTACCCTCCACT No data
Right 993034854 5:82745506-82745528 AACTGTCTCCAGACATGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034844 Original CRISPR AGTGGAGGGTAAGGATGGGA AGG (reversed) Intergenic
No off target data available for this crispr