ID: 993034847

View in Genome Browser
Species Human (GRCh38)
Location 5:82745477-82745499
Sequence GCCGCAGTGGAGGGTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034847_993034854 6 Left 993034847 5:82745477-82745499 CCATCCTTACCCTCCACTGCGGC No data
Right 993034854 5:82745506-82745528 AACTGTCTCCAGACATGGCTAGG No data
993034847_993034852 1 Left 993034847 5:82745477-82745499 CCATCCTTACCCTCCACTGCGGC No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034847 Original CRISPR GCCGCAGTGGAGGGTAAGGA TGG (reversed) Intergenic