ID: 993034848

View in Genome Browser
Species Human (GRCh38)
Location 5:82745481-82745503
Sequence GGTTGCCGCAGTGGAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034848_993034852 -3 Left 993034848 5:82745481-82745503 CCTTACCCTCCACTGCGGCAACC No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034848_993034854 2 Left 993034848 5:82745481-82745503 CCTTACCCTCCACTGCGGCAACC No data
Right 993034854 5:82745506-82745528 AACTGTCTCCAGACATGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034848 Original CRISPR GGTTGCCGCAGTGGAGGGTA AGG (reversed) Intergenic
No off target data available for this crispr