ID: 993034851

View in Genome Browser
Species Human (GRCh38)
Location 5:82745490-82745512
Sequence GACAGTTTTGGTTGCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034851_993034860 29 Left 993034851 5:82745490-82745512 CCACTGCGGCAACCAAAACTGTC No data
Right 993034860 5:82745542-82745564 CAAAATTGTCACCATAACACTGG No data
993034851_993034854 -7 Left 993034851 5:82745490-82745512 CCACTGCGGCAACCAAAACTGTC No data
Right 993034854 5:82745506-82745528 AACTGTCTCCAGACATGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034851 Original CRISPR GACAGTTTTGGTTGCCGCAG TGG (reversed) Intergenic
No off target data available for this crispr