ID: 993034852

View in Genome Browser
Species Human (GRCh38)
Location 5:82745501-82745523
Sequence ACCAAAACTGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034845_993034852 2 Left 993034845 5:82745476-82745498 CCCATCCTTACCCTCCACTGCGG No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034850_993034852 -9 Left 993034850 5:82745487-82745509 CCTCCACTGCGGCAACCAAAACT No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034849_993034852 -8 Left 993034849 5:82745486-82745508 CCCTCCACTGCGGCAACCAAAAC No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034847_993034852 1 Left 993034847 5:82745477-82745499 CCATCCTTACCCTCCACTGCGGC No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034848_993034852 -3 Left 993034848 5:82745481-82745503 CCTTACCCTCCACTGCGGCAACC No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034843_993034852 26 Left 993034843 5:82745452-82745474 CCTACTGGATGCTAGGAGTACCT No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data
993034844_993034852 6 Left 993034844 5:82745472-82745494 CCTTCCCATCCTTACCCTCCACT No data
Right 993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034852 Original CRISPR ACCAAAACTGTCTCCAGACA TGG Intergenic
No off target data available for this crispr