ID: 993034860

View in Genome Browser
Species Human (GRCh38)
Location 5:82745542-82745564
Sequence CAAAATTGTCACCATAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993034853_993034860 17 Left 993034853 5:82745502-82745524 CCAAAACTGTCTCCAGACATGGC No data
Right 993034860 5:82745542-82745564 CAAAATTGTCACCATAACACTGG No data
993034855_993034860 5 Left 993034855 5:82745514-82745536 CCAGACATGGCTAGGTGTCCCCC No data
Right 993034860 5:82745542-82745564 CAAAATTGTCACCATAACACTGG No data
993034851_993034860 29 Left 993034851 5:82745490-82745512 CCACTGCGGCAACCAAAACTGTC No data
Right 993034860 5:82745542-82745564 CAAAATTGTCACCATAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993034860 Original CRISPR CAAAATTGTCACCATAACAC TGG Intergenic
No off target data available for this crispr