ID: 993038039

View in Genome Browser
Species Human (GRCh38)
Location 5:82779163-82779185
Sequence CTGTAGTTAAGGAAAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993038039_993038045 14 Left 993038039 5:82779163-82779185 CCAGACCCTTTCCTTAACTACAG No data
Right 993038045 5:82779200-82779222 TGTGAGAACTGACCCAAAGATGG No data
993038039_993038046 17 Left 993038039 5:82779163-82779185 CCAGACCCTTTCCTTAACTACAG No data
Right 993038046 5:82779203-82779225 GAGAACTGACCCAAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993038039 Original CRISPR CTGTAGTTAAGGAAAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr