ID: 993038702

View in Genome Browser
Species Human (GRCh38)
Location 5:82787481-82787503
Sequence CAGAGTAAAAAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993038697_993038702 -2 Left 993038697 5:82787460-82787482 CCAACCAGTTGAGGAGCTAAACA No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data
993038694_993038702 3 Left 993038694 5:82787455-82787477 CCTCCCCAACCAGTTGAGGAGCT No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data
993038696_993038702 -1 Left 993038696 5:82787459-82787481 CCCAACCAGTTGAGGAGCTAAAC No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data
993038695_993038702 0 Left 993038695 5:82787458-82787480 CCCCAACCAGTTGAGGAGCTAAA No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data
993038693_993038702 4 Left 993038693 5:82787454-82787476 CCCTCCCCAACCAGTTGAGGAGC No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data
993038698_993038702 -6 Left 993038698 5:82787464-82787486 CCAGTTGAGGAGCTAAACAGAGT No data
Right 993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993038702 Original CRISPR CAGAGTAAAAAGGTGGAGGA AGG Intergenic
No off target data available for this crispr