ID: 993041715

View in Genome Browser
Species Human (GRCh38)
Location 5:82822187-82822209
Sequence CAGAATAAGCTTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993041715_993041720 21 Left 993041715 5:82822187-82822209 CCCTCCTCCTCAAGCTTATTCTG No data
Right 993041720 5:82822231-82822253 TGCTTAGAAACAAATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993041715 Original CRISPR CAGAATAAGCTTGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr