ID: 993041892

View in Genome Browser
Species Human (GRCh38)
Location 5:82823961-82823983
Sequence TCAGCCTTTCAGGGAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993041885_993041892 22 Left 993041885 5:82823916-82823938 CCAGAAGCCAGAGGGCAAGAAAT No data
Right 993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG No data
993041888_993041892 -1 Left 993041888 5:82823939-82823961 CCATTGACACAGACCATATAGGT No data
Right 993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG No data
993041884_993041892 26 Left 993041884 5:82823912-82823934 CCAACCAGAAGCCAGAGGGCAAG No data
Right 993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG No data
993041886_993041892 15 Left 993041886 5:82823923-82823945 CCAGAGGGCAAGAAATCCATTGA No data
Right 993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993041892 Original CRISPR TCAGCCTTTCAGGGAAAAGC AGG Intergenic
No off target data available for this crispr