ID: 993042038

View in Genome Browser
Species Human (GRCh38)
Location 5:82825154-82825176
Sequence TTCTCAAGGCTTCCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993042038_993042048 29 Left 993042038 5:82825154-82825176 CCTGTCTGGGGAAGCCTTGAGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 993042048 5:82825206-82825228 GGCCCATCACAGCCCTAGACTGG No data
993042038_993042041 -2 Left 993042038 5:82825154-82825176 CCTGTCTGGGGAAGCCTTGAGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 993042041 5:82825175-82825197 AAAGAGGCCTGACCCACTTCTGG 0: 1
1: 0
2: 1
3: 18
4: 128
993042038_993042042 1 Left 993042038 5:82825154-82825176 CCTGTCTGGGGAAGCCTTGAGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 993042042 5:82825178-82825200 GAGGCCTGACCCACTTCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 181
993042038_993042044 8 Left 993042038 5:82825154-82825176 CCTGTCTGGGGAAGCCTTGAGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 993042044 5:82825185-82825207 GACCCACTTCTGGAGGTCCTAGG No data
993042038_993042049 30 Left 993042038 5:82825154-82825176 CCTGTCTGGGGAAGCCTTGAGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 993042049 5:82825207-82825229 GCCCATCACAGCCCTAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993042038 Original CRISPR TTCTCAAGGCTTCCCCAGAC AGG (reversed) Intergenic
906127179 1:43434066-43434088 TTCTCAAGTCTTCTTCAGAATGG - Intronic
906388383 1:45392046-45392068 TTCTGACTCCTTCCCCAGACTGG + Intronic
909204110 1:72731370-72731392 TGCTTAACGCTTCTCCAGACTGG - Intergenic
910712712 1:90198315-90198337 TTTTCAAGATTTCCACAGACAGG + Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
913397019 1:118382543-118382565 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
915128722 1:153682743-153682765 TTCTGGTGGCTTCCCCAGACTGG - Intronic
916860044 1:168793868-168793890 TTCTCAAGGATTACTCAGCCAGG + Intergenic
917739809 1:177951515-177951537 TTCTGCAGGCTTCCCCTGGCAGG - Intronic
918067666 1:181112525-181112547 TTCACAAGGCCTCACCAGCCAGG - Intergenic
918211962 1:182359096-182359118 TTCGCTAGGCTTGCCCAGGCTGG + Intergenic
919124523 1:193379031-193379053 TTCCCAAGGCCTCCCCAGCCAGG + Intergenic
919579163 1:199349694-199349716 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
920059796 1:203219424-203219446 TTCTCCAGGCTTCCTCAGACAGG - Intronic
920388635 1:205585045-205585067 TTCTCTTGCCTTTCCCAGACTGG - Intronic
923665551 1:235995661-235995683 TTCTGAAGGATTAACCAGACAGG - Intronic
1063813678 10:9745190-9745212 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1064013930 10:11758547-11758569 GTCTCCAGCCTGCCCCAGACAGG + Intronic
1070729329 10:78814413-78814435 TTTTCAAGGTTTCCCAAGGCAGG + Intergenic
1073692359 10:105823732-105823754 TTCTCAAGGCATCCCCATTGAGG - Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077856148 11:6128212-6128234 TTCTCAAAGGTTCCCAAGAATGG + Intergenic
1078155986 11:8800460-8800482 TTCTGCAGGCTTCCACAGGCAGG - Intronic
1079003270 11:16775161-16775183 TTTTCATGTCTTCCCCAGTCAGG + Intergenic
1079562324 11:21837633-21837655 TTTTCTAGGCTTACCTAGACCGG - Intergenic
1084941697 11:72616609-72616631 CTCTCAAAGCCTCCCCAGTCTGG + Intronic
1086086098 11:82956610-82956632 CTCTCACGGCTTCCCTTGACTGG + Intronic
1086256791 11:84886465-84886487 TCTTCAAGGCTTCCCAAGGCAGG - Intronic
1087186171 11:95198243-95198265 TTCTCAAAGCTTCCCAACAATGG - Intronic
1087238455 11:95748378-95748400 TTCTCCATGCTTCCCATGACCGG + Intergenic
1094533367 12:31298635-31298657 TGCTCAAAACTTCCCCAGAGGGG - Intronic
1095991588 12:48038106-48038128 TTCTCTTGGCTTCTCCAGACAGG - Intergenic
1097574067 12:61369361-61369383 TTCTAAAGAGTTCCCCAGAGTGG - Intergenic
1097590833 12:61573313-61573335 TTCACAATGCTTCCCCTGTCAGG + Intergenic
1097861719 12:64524420-64524442 TCCTCCAAGCTTCCCCAGAGTGG + Intergenic
1099530419 12:83772658-83772680 TCCTTAAGTCTTCCCCAGACTGG + Intergenic
1100390621 12:94143417-94143439 TTCCCAGGGCTTCCCCAGGATGG + Intergenic
1100854637 12:98748313-98748335 GTCTCAAGGCTTAGCCTGACTGG - Intronic
1103815309 12:123650316-123650338 TTCTCCAGTCTTCCCCGCACTGG + Intronic
1104742136 12:131185375-131185397 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1106480714 13:30135186-30135208 TTCACACGGCTTCCCCAGGCTGG - Intergenic
1108464531 13:50701621-50701643 TGATCAAGGCTTCCCTTGACTGG + Intronic
1110329695 13:74257255-74257277 TTCCCAAGCCCTCCCCAGAAAGG - Intergenic
1110914745 13:81008098-81008120 TTCCTGAGGCTTCCCCAGTCAGG + Intergenic
1110922844 13:81110802-81110824 TTGCAAAGGCTTCGCCAGACAGG + Intergenic
1111441515 13:88287140-88287162 TTCTTGAGGCCTCCCCAGCCGGG - Intergenic
1111834682 13:93373542-93373564 TTCTCAAGGATTCAACATACAGG - Intronic
1112604432 13:100890271-100890293 TTCTCTAGGGTTCACCAGCCTGG + Intergenic
1113405464 13:110035033-110035055 TTCACACGGCATCCCGAGACAGG + Intergenic
1115136246 14:30111846-30111868 TGATCAATGCTTCCCCAGGCAGG + Intronic
1116786455 14:49293970-49293992 TTCTCAAGTCTCCTCCAGAGGGG - Intergenic
1118326524 14:64785237-64785259 TCCTCAAAGCTGGCCCAGACTGG + Intronic
1121662087 14:95642554-95642576 GTCACAAGGCTTCCCCCGGCAGG - Intergenic
1121779444 14:96613018-96613040 ATCTCAGGGCTACACCAGACTGG - Intergenic
1127839219 15:62816120-62816142 CTCTAAAGGATTCCCCAGGCGGG - Intronic
1127914055 15:63441080-63441102 TTCTCAGGGCTTCCCCTACCTGG - Intergenic
1129461176 15:75700734-75700756 GTCTCGGGGCTTCCCCAGCCTGG + Intronic
1129723653 15:77891008-77891030 GTCTCGGGGCTTCCCCAGCCTGG - Intergenic
1132806702 16:1778335-1778357 CTCTCAGGGCTGCCCCAGCCTGG - Intronic
1136586147 16:31186394-31186416 TGTTCAAGGCTACCCCAGCCTGG + Intronic
1137353196 16:47732624-47732646 ATCTCAGGCCTACCCCAGACAGG - Intergenic
1137496217 16:48971398-48971420 TTAACAAGCCCTCCCCAGACCGG - Intergenic
1140256198 16:73338336-73338358 TTCTCAGAGCTTCCCCAACCGGG + Intergenic
1140331514 16:74061682-74061704 TTCTTGAGGCCTCCCCAGAAGGG + Intergenic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1144678598 17:17177559-17177581 TTCACACGGCTGCCCCAGACAGG + Intronic
1144960478 17:19041643-19041665 TTCTGAGGACTTCCCCAGAGTGG - Intronic
1144974682 17:19132881-19132903 TTCTGAGGACTTCCCCAGAGTGG + Intronic
1148403311 17:47386843-47386865 CTCTCAAGGCTTCCCTTGGCTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1153087309 18:1303006-1303028 TGTTTAAGTCTTCCCCAGACAGG - Intergenic
1153466539 18:5394637-5394659 TTCTCTAGGCTTGCCTAGGCTGG - Intronic
1154178502 18:12108287-12108309 TTCCTGAGGCTTCCCCAGCCAGG - Intronic
1154497887 18:14975599-14975621 TTCTGCAGGCCTCCCCAGCCTGG - Intergenic
1156133846 18:34011533-34011555 TTCTCAAGGCATCTACAGACTGG + Intronic
1156959655 18:43009766-43009788 TTCTCAACGCTGCATCAGACGGG - Intronic
1157316497 18:46594205-46594227 TTCTCAAGTCTCCTCCAGAAAGG - Intronic
1157429583 18:47613759-47613781 GTCTGCAGGCTTCCCCAGAGAGG + Intergenic
1160431296 18:78814583-78814605 TTCTCAAGCCGTGCCCAGCCAGG - Intergenic
1161171961 19:2816565-2816587 TTTTCCAGGCTGCACCAGACCGG + Intergenic
1161977366 19:7613831-7613853 TTCCCATGGCTTTCCCAGCCGGG + Intronic
1163520006 19:17786533-17786555 TAATCAGGGCTTCCCCAGAGAGG - Intronic
1168133367 19:54335396-54335418 TTCCCGAGGCCTCCCCAGCCAGG + Intronic
925084786 2:1099545-1099567 TGGTTAAGGCTTCCCCAGCCTGG - Intronic
925705949 2:6684834-6684856 TTCTAAAGGCAGCCCCAGGCAGG - Intergenic
927906683 2:26863422-26863444 TTCTCAAATCTTGCCCAGAATGG + Intronic
928261162 2:29767910-29767932 TCATCACGACTTCCCCAGACTGG - Intronic
930690118 2:54353507-54353529 TTTTCAAGGCTTCTGCAGAGGGG + Intronic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
932859398 2:75274276-75274298 TGCTTAAGCCTTCCCCAGAGTGG - Intergenic
933131895 2:78682283-78682305 TCCTCAAGTCTTCCCCACAGTGG - Intergenic
933581113 2:84128086-84128108 ATATCAAGGCTTCCACAGCCTGG - Intergenic
936682020 2:114784964-114784986 TTTTCAAGTCTTCCCCATTCTGG + Intronic
937310094 2:120896764-120896786 TTCTCAAGGAATCCCCAGCTTGG + Intronic
937480333 2:122251705-122251727 TAGTCAAGTCTTCCCCAGAGTGG - Intergenic
940076135 2:149744058-149744080 TCCTCGAGGATTCCTCAGACAGG + Intergenic
942463649 2:176187184-176187206 TTCTAAAGACTTCCTCAGAGTGG + Intergenic
943722683 2:191221388-191221410 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
944503062 2:200381764-200381786 TTCTCATGGCTGCCTCAGAGGGG - Intronic
946576180 2:221078029-221078051 TTCTCATGGCCTCACCATACAGG - Intergenic
1171210479 20:23312837-23312859 TTCCCAGGGCTTCACCAGATGGG + Intergenic
1172795529 20:37534547-37534569 TTCTCAGGGCTTTCTCAGATGGG + Intergenic
1174549266 20:51349887-51349909 TCCTAAAGGCTGCCCCAGAAAGG - Intergenic
1174700378 20:52602434-52602456 CTCTCGAGGCTTCCCCTGCCTGG - Intergenic
1176233026 20:64041648-64041670 GTCCCGAGGCCTCCCCAGACTGG + Intronic
1179981694 21:44899269-44899291 CTCTCCAGCCTTCCCCAGAGAGG - Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1181967295 22:26666261-26666283 TTCTCTGGTCTTCTCCAGACTGG + Intergenic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1183676252 22:39300416-39300438 TTCTCCAGGCTTCCAGAGAAGGG - Intergenic
1184592548 22:45494732-45494754 TTCCTGAGGCCTCCCCAGACAGG - Intergenic
950566005 3:13770106-13770128 TTCTCAGGGCTTCCCCACTCTGG - Intergenic
952197685 3:31093250-31093272 TTCCCAACCCTTCTCCAGACAGG + Intergenic
952220608 3:31320475-31320497 TTCTCAAAGCATCCCCAGTAAGG + Intergenic
952881140 3:37986990-37987012 TTCTCCAGTCTTTCCCAGGCAGG - Intergenic
955010237 3:55006739-55006761 TTCTCAAAACTTTCCCAGTCCGG - Intronic
956527848 3:70184766-70184788 TTCCCAAAGATTCCCCAGAAAGG - Intergenic
956663246 3:71619432-71619454 TTCTCAGGAGTTCCCCAGTCTGG - Intergenic
956872352 3:73430549-73430571 TCCTCAAAGCATCCACAGACTGG + Intronic
957257262 3:77854398-77854420 TTTTCCAGGCTTCCCCAGGTTGG - Intergenic
957657468 3:83099260-83099282 TTCCCGAGGCCTCCCCAGACAGG + Intergenic
960282362 3:115793377-115793399 TTCTCTACTCTTCTCCAGACTGG - Intergenic
960752451 3:120971041-120971063 TGCTTAAGTCTTCCCCAGACTGG - Intronic
961430547 3:126879396-126879418 TTCTCAATGCATCCCATGACTGG - Intronic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
962852596 3:139319067-139319089 TCCTCCAGCCTTCCCCAGGCAGG - Intronic
963301764 3:143605379-143605401 TTCTCCTGGGTTCCACAGACAGG - Intronic
965771496 3:172186482-172186504 TTGTCAAGCTTTTCCCAGACTGG - Intronic
968453590 4:686444-686466 GAGTCAAGGCCTCCCCAGACCGG - Intronic
968862550 4:3184360-3184382 CTCTCAAGGCTCCTCCACACTGG - Intronic
972268212 4:37483238-37483260 TTCCCAAGGCCTTCCCAGACAGG + Intronic
972875903 4:43359580-43359602 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
974967730 4:68783616-68783638 TTCTTAAGCCTTCCCCAACCCGG - Intergenic
976333988 4:83864465-83864487 TTCTCTAGGCTACTCCACACGGG - Intergenic
976579118 4:86714222-86714244 TTCTCAAGCCTTAGCCAAACAGG + Intronic
977432293 4:96945137-96945159 TGCTTAAGTCTTCCCCAGACTGG + Intergenic
978189782 4:105897587-105897609 TTCTCAAGGCTGCCACTCACAGG - Intronic
978436307 4:108688153-108688175 TTCACAAGGCCACCTCAGACAGG + Intergenic
980318731 4:131239989-131240011 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
980672359 4:136026155-136026177 TTCTCATAGCTTCACTAGACAGG - Intergenic
981383774 4:144103209-144103231 TTCTCAAGGATTCTGCAGACAGG - Intergenic
982212674 4:153051848-153051870 TTCTTGAGGCCTCCCCAGCCAGG - Intergenic
984551114 4:181159990-181160012 TTATCAATGCTACCCCAAACTGG - Intergenic
986266041 5:6191160-6191182 CTCTCCAGGCTTCCTCAGAGTGG + Intergenic
987443277 5:17984160-17984182 TTTCCAAGGCTACACCAGACTGG + Intergenic
990857795 5:60290174-60290196 TTCTCAACCCATCCCCACACTGG - Intronic
991184977 5:63795873-63795895 TTCCTGAGGCCTCCCCAGACAGG - Intergenic
991307671 5:65197137-65197159 TTCTCAAGGTGTCCAAAGACAGG - Exonic
992463387 5:76983782-76983804 TTTTCAAGTCTTCCCCTCACTGG + Intergenic
993042038 5:82825154-82825176 TTCTCAAGGCTTCCCCAGACAGG - Intergenic
995417973 5:111931345-111931367 TTCTCCTGGATTACCCAGACTGG + Intronic
995504929 5:112850401-112850423 TTCACAAGTGTTCCCCAAACTGG - Intronic
996442757 5:123510952-123510974 TTCTCACTTCTTCCCCAAACTGG - Intergenic
997372946 5:133373676-133373698 TGATCAAGGCTTCCCAAGAAGGG - Intronic
999082914 5:148861177-148861199 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
999408448 5:151327711-151327733 TTCACAAGGCCTGCTCAGACTGG + Intronic
1001249703 5:170137733-170137755 TTCTCCAGCCTCCCCCTGACTGG + Intergenic
1002568105 5:180124934-180124956 TTCTCCATGTTTGCCCAGACTGG - Intronic
1005499447 6:26417330-26417352 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1007610610 6:43146510-43146532 TTCTCACTGCCTCCCCAGGCAGG + Intronic
1010671135 6:78688005-78688027 TTCTCAAGGCTTCCAATCACAGG - Intergenic
1011026173 6:82871927-82871949 TTCCCAAGTCCTCCCCAGCCAGG + Intergenic
1011973610 6:93262183-93262205 TTTTTAACACTTCCCCAGACAGG - Intronic
1012737805 6:102973538-102973560 TCTTCAAGGGTTCCCCAGAGAGG + Intergenic
1012956209 6:105572846-105572868 TTCCAAGAGCTTCCCCAGACTGG - Intergenic
1013376948 6:109526651-109526673 TTCTCAGGGCTTCCTGACACAGG + Intronic
1013626363 6:111941040-111941062 TTCTCAAGGGTGCCCCAGCTTGG - Intergenic
1014032349 6:116720055-116720077 TTCTCAATGCTACCAAAGACTGG - Intronic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1016594294 6:145781815-145781837 TCCTTAAGTCTTCCCCAAACTGG + Intergenic
1020264762 7:6552999-6553021 TTCTAAAGTCTCCCCCAGGCTGG - Intergenic
1024093900 7:45969337-45969359 TTCTGAAGGCTTGCCCATGCTGG + Intergenic
1024986682 7:55200298-55200320 TTCTCATTCCTTCCCCAGGCTGG + Exonic
1027778293 7:82492929-82492951 TTCTCAAGGCTTCCCTTGGCTGG + Intergenic
1029508785 7:100979993-100980015 TTCTCAATGTGCCCCCAGACTGG - Intronic
1030164377 7:106538987-106539009 GTTTGAAGGCTTCCCCAGATGGG + Intergenic
1030933971 7:115561584-115561606 TTCTCCAGCCTTCCCCCTACTGG - Intergenic
1031423989 7:121583939-121583961 TTTTCTAGGCTTCACCAGATTGG - Intergenic
1032114239 7:129103414-129103436 GTCTCAGGGCTTGGCCAGACTGG - Intergenic
1032360629 7:131251697-131251719 TACTCAAGTCTTGCCCAGATTGG + Intronic
1033234501 7:139627410-139627432 TTCTCATGGGTTCCCCAGTTAGG + Intronic
1034029068 7:147740066-147740088 TTCTCCAGGCATCCACAGAGGGG + Intronic
1035105579 7:156439685-156439707 TTCTCCAGGTTTCCCCTAACAGG + Intergenic
1036118583 8:5988657-5988679 TTCTCAAGGATCCCTCAGATTGG - Intergenic
1036822877 8:11954104-11954126 TTCTCAAAGCTCCCCAAGAGGGG - Intergenic
1037225210 8:16579396-16579418 TTTTCCAGGCTACCACAGACTGG - Intergenic
1038053497 8:23836021-23836043 TTCCCAAGACGTCCCCAGCCAGG - Intergenic
1042022894 8:64389001-64389023 TTCTCACAGCTTCCACAGAGAGG + Intergenic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1045418960 8:101995127-101995149 TTCTCAAGAAGTCCCCAGTCTGG - Intronic
1047022993 8:120796218-120796240 TTCCCAAGGCATCTCCAGCCAGG + Intronic
1047341527 8:123985110-123985132 TTCTCAAGGAGTCCACAGTCTGG - Intronic
1050049387 9:1583354-1583376 TTTTCAAGGCTACCACAGATGGG + Intergenic
1050129514 9:2396796-2396818 TCTTTAAGCCTTCCCCAGACAGG + Intergenic
1050451965 9:5791368-5791390 TTCTCAAGGCCTTCACTGACGGG + Intronic
1050481228 9:6088918-6088940 TTCACAAGGCTACCCCACGCTGG + Intergenic
1050643277 9:7692146-7692168 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
1056900764 9:90597287-90597309 TTCTCTAGGCTTCTCCATCCTGG - Intergenic
1059374655 9:113872761-113872783 TTCTCTTGGCTTCCCCACACTGG + Intergenic
1185749259 X:2597520-2597542 TTCCTGAGGCTTCCCCAGTCAGG - Intergenic
1186057976 X:5671683-5671705 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1186809860 X:13177681-13177703 ATCTCAGGGCTACCTCAGACTGG - Intergenic
1186863396 X:13695094-13695116 TTCTCGAGACTTCTCCAGACAGG - Intronic
1188333448 X:28899041-28899063 TTCCTGAGGCCTCCCCAGACAGG - Intronic
1192953234 X:76039825-76039847 CTCTCAAGGCTTCCCTTGGCTGG + Intergenic
1196047664 X:111273216-111273238 TTCTCAAAGGTTACCAAGACTGG + Intergenic
1198330515 X:135618369-135618391 TTCTCAAGGATTCCCCTGCCAGG - Intergenic
1198336413 X:135670627-135670649 TTCTCAAGGATTCCCCTGCCAGG + Intergenic
1198363216 X:135915995-135916017 TTCTCAAGGATTCCCCTGCCAGG - Intergenic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic