ID: 993044445

View in Genome Browser
Species Human (GRCh38)
Location 5:82851638-82851660
Sequence TTGGAATGCTTAGAAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993044445_993044447 -6 Left 993044445 5:82851638-82851660 CCAGTTTTTTCTAAGCATTCCAA No data
Right 993044447 5:82851655-82851677 TTCCAAACTATGTACTATGTGGG No data
993044445_993044446 -7 Left 993044445 5:82851638-82851660 CCAGTTTTTTCTAAGCATTCCAA No data
Right 993044446 5:82851654-82851676 ATTCCAAACTATGTACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993044445 Original CRISPR TTGGAATGCTTAGAAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr