ID: 993048194

View in Genome Browser
Species Human (GRCh38)
Location 5:82892970-82892992
Sequence CTTCACTAGCAGAATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993048189_993048194 28 Left 993048189 5:82892919-82892941 CCCCATCGTCACAAGCTTACACC No data
Right 993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG No data
993048190_993048194 27 Left 993048190 5:82892920-82892942 CCCATCGTCACAAGCTTACACCT No data
Right 993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG No data
993048192_993048194 7 Left 993048192 5:82892940-82892962 CCTTTACTATTGCTGTTCTGAGA No data
Right 993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG No data
993048191_993048194 26 Left 993048191 5:82892921-82892943 CCATCGTCACAAGCTTACACCTT No data
Right 993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993048194 Original CRISPR CTTCACTAGCAGAATGTGCT GGG Intergenic
No off target data available for this crispr