ID: 993050973

View in Genome Browser
Species Human (GRCh38)
Location 5:82925500-82925522
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993050969_993050973 11 Left 993050969 5:82925466-82925488 CCACATTAGGGGAACTGACTTAT No data
Right 993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr