ID: 993058761

View in Genome Browser
Species Human (GRCh38)
Location 5:83013913-83013935
Sequence GTAAGAAATTCTTATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993058758_993058761 27 Left 993058758 5:83013863-83013885 CCTTGGAAGGAAAGTACAAATGT No data
Right 993058761 5:83013913-83013935 GTAAGAAATTCTTATACTGCTGG No data
993058757_993058761 28 Left 993058757 5:83013862-83013884 CCCTTGGAAGGAAAGTACAAATG No data
Right 993058761 5:83013913-83013935 GTAAGAAATTCTTATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993058761 Original CRISPR GTAAGAAATTCTTATACTGC TGG Intergenic
No off target data available for this crispr