ID: 993060160

View in Genome Browser
Species Human (GRCh38)
Location 5:83029440-83029462
Sequence AGCACCACATGGCAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993060160_993060164 2 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060164 5:83029465-83029487 GAGAAGATCTGTGCTCTTGGTGG No data
993060160_993060163 -1 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060163 5:83029462-83029484 TGAGAGAAGATCTGTGCTCTTGG No data
993060160_993060167 22 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060167 5:83029485-83029507 TGGGGAGAGTGCAGTGATTGTGG No data
993060160_993060165 3 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060165 5:83029466-83029488 AGAAGATCTGTGCTCTTGGTGGG No data
993060160_993060168 23 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG No data
993060160_993060166 4 Left 993060160 5:83029440-83029462 CCCAGCAGCTGCCATGTGGTGCT No data
Right 993060166 5:83029467-83029489 GAAGATCTGTGCTCTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993060160 Original CRISPR AGCACCACATGGCAGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr